ID: 997602326

View in Genome Browser
Species Human (GRCh38)
Location 5:135149237-135149259
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997602324_997602326 5 Left 997602324 5:135149209-135149231 CCGTCTTTAAATGGGCATGGACC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 385
997602320_997602326 15 Left 997602320 5:135149199-135149221 CCAAGAGCAACCGTCTTTAAATG 0: 1
1: 0
2: 1
3: 9
4: 100
Right 997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 38
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
905329665 1:37185153-37185175 AACTATTAATAGAGATAAGAAGG + Intergenic
906221694 1:44085494-44085516 TTCCATTAAGAAAGAGAAGTTGG + Intergenic
907164762 1:52400585-52400607 CTCGTTCAAGAGACAGAAGAAGG - Intronic
907315439 1:53567930-53567952 CTCTATTAAGGCAGTGAAAAGGG + Intronic
909205235 1:72748131-72748153 ATCTATTATAAGAGAGAAGAAGG + Intergenic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
911862683 1:102973240-102973262 TTCTAGTAGGAGAGACAAGAAGG - Intronic
912625678 1:111203553-111203575 CTCTGCTAAGAAAGAAAAGAAGG + Intronic
916828642 1:168468180-168468202 CTTTATTAAGTGAAAAAAGATGG + Intergenic
916964924 1:169928397-169928419 CTATTTTAAAAGAGAAAAGATGG - Intronic
918204346 1:182295951-182295973 ATCTGCTGAGAGAGAGAAGAAGG - Intergenic
918217666 1:182407138-182407160 CTAAATTGAGAGAGAGAACAGGG + Intergenic
918305247 1:183240111-183240133 CTCTCTGAAGAGTGAGATGAGGG + Exonic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
919659128 1:200226317-200226339 CTAGATGAAGAGAGAAAAGAGGG - Intergenic
921657313 1:217755963-217755985 CTTTATTAAGACATAGAAGGGGG - Intronic
922008503 1:221556427-221556449 CACTGAAAAGAGAGAGAAGATGG + Intergenic
923522099 1:234743080-234743102 CCCTAGCAAGAGAGAGAAGCAGG - Intergenic
1063542234 10:6945399-6945421 CACATTTAAGAGAGAGGAGAAGG - Intergenic
1064133570 10:12731253-12731275 CTCTATGAAGGGAGAGAATGTGG + Intronic
1065294413 10:24260877-24260899 CTCTATTCACAGACAGAACAGGG - Intronic
1066304945 10:34131361-34131383 CTCTATGAAACGAGACAAGATGG - Intronic
1067908082 10:50315194-50315216 CTCTATTAAGAGAAAAAAACAGG + Intronic
1067917873 10:50420260-50420282 AACCATTAAGAGAGAAAAGAGGG - Intronic
1068304952 10:55196416-55196438 CTCTATTGAAAGAGATAATAGGG - Intronic
1068672525 10:59738353-59738375 CTCTATTTGGAGAGAGTTGAAGG - Intergenic
1068710262 10:60126235-60126257 ATCTACTCAGAGAGAGAACAGGG + Intronic
1068942600 10:62694178-62694200 TTCTATTAACAGAAAGAAGAGGG - Intergenic
1069815512 10:71191442-71191464 CTCTCTGAAGAGGGAGAACAAGG + Intergenic
1073122448 10:101131087-101131109 GTTCATGAAGAGAGAGAAGAGGG - Exonic
1073355646 10:102851789-102851811 CACTATTAAGATACAGAACAGGG - Intergenic
1073835719 10:107438820-107438842 CACTATTAAGAGAATGAACAAGG - Intergenic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1074031133 10:109689620-109689642 GTGTATCAAGAGAGAGCAGAAGG - Intergenic
1074575570 10:114665547-114665569 CTCTATTTAGAGAGATAACATGG + Intronic
1074753000 10:116604987-116605009 ATCTATTAAGAGAAAGAGGCCGG - Intronic
1075355240 10:121766445-121766467 CTCTGAAAAGTGAGAGAAGACGG + Intronic
1076286838 10:129307728-129307750 CTCTGGTGAGAGAGAGAAGGTGG + Intergenic
1079409468 11:20173833-20173855 CTCTAGTAAGAGATAGCATATGG + Intergenic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1079763534 11:24359905-24359927 TTTCATTAAGAAAGAGAAGAGGG + Intergenic
1079868701 11:25768048-25768070 CTATAATGAGAGAGAGAGGAAGG + Intergenic
1079969623 11:27020270-27020292 CTCTATTGTGAGAGGAAAGAGGG - Intergenic
1080883063 11:36340685-36340707 CTCTAAAAGGAGAGAGAAGCAGG + Intronic
1082759197 11:57109996-57110018 CACTATTGGGAGATAGAAGAGGG - Intergenic
1082930643 11:58601142-58601164 CTCTCTTAAAAAATAGAAGATGG - Intronic
1083037519 11:59653640-59653662 CTCTATGAAGGAAGAGAAGCTGG - Intronic
1083193977 11:61072073-61072095 ATTTTTAAAGAGAGAGAAGAGGG + Intergenic
1083568394 11:63740595-63740617 CTCTATTAAAAGAAAAAAAAAGG - Intronic
1084091816 11:66883608-66883630 GTCTATTAAAGGAGACAAGACGG - Intronic
1084143658 11:67251232-67251254 CTCCATTCAGTGAGAGAAGTGGG + Intronic
1084292105 11:68179295-68179317 TTCTATTAAGGGAGGGAGGACGG - Intronic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085237161 11:75023986-75024008 CTCTGTAAAGAGAGACATGAAGG - Intergenic
1086775955 11:90833196-90833218 GTCTATAAAGAGGGAGAAGGAGG + Intergenic
1087745986 11:101947375-101947397 CAATATTTAGAGAGAGAAGTAGG + Intronic
1088200785 11:107331427-107331449 CACTAATAAGAGAGATAGGAAGG + Intronic
1089771736 11:120808028-120808050 ATTGATGAAGAGAGAGAAGAAGG + Intronic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1090815954 11:130295809-130295831 CTCTAGTAGGTGAGAGAACAAGG - Intronic
1091248942 11:134125219-134125241 CTAAGTTGAGAGAGAGAAGAGGG - Intronic
1091459843 12:635771-635793 CACTATTAAAAGAGTGAAAAGGG + Intronic
1091986714 12:4915443-4915465 CTCGATTAAAAGAAAGAACATGG + Exonic
1092043174 12:5403618-5403640 CTATTTTAAGGGATAGAAGATGG + Intergenic
1092255284 12:6923727-6923749 CCCTATGAGGGGAGAGAAGATGG + Intergenic
1094009756 12:25794982-25795004 CTCTGTCAAGAGGCAGAAGAGGG + Intergenic
1095295206 12:40519801-40519823 TTCTATTAAGTCAGAAAAGAAGG - Intronic
1095295621 12:40524388-40524410 TTCTATTAAGTCAGAAAAGAAGG - Intronic
1095324179 12:40867847-40867869 TTCTGTAAAGGGAGAGAAGATGG + Intronic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096204367 12:49708202-49708224 CTCCATTTAGACTGAGAAGAGGG - Intronic
1096343433 12:50823473-50823495 CTCTATATAGAGAGAGGAAAAGG - Intergenic
1096928341 12:55173951-55173973 CTCCAACAAGAGAGAGAAAAGGG - Intergenic
1097208766 12:57348264-57348286 CTCTATTAAGAAATAAAAAAAGG + Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098365761 12:69701322-69701344 CTCTTTTAAGAAAGAAAATATGG - Intergenic
1098515005 12:71365174-71365196 ATCTATAAAGGGAGAGAAAATGG + Intronic
1098682160 12:73369880-73369902 CTCCAAAAAGAGAGAGAAGAAGG + Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1099487640 12:83248318-83248340 CTCTATTATGAGAGAGCACTAGG - Intergenic
1102558022 12:113741802-113741824 ACCTATAAAGAGAGAGGAGAGGG + Intergenic
1102984014 12:117264272-117264294 GTCTCTTAAGAGAGAGAAAGAGG - Intronic
1103240996 12:119413282-119413304 TTCAATCAAGTGAGAGAAGAGGG + Intronic
1103714965 12:122939830-122939852 CTCTATTAAAAAAGAAAAAAAGG - Intronic
1104124913 12:125837305-125837327 TGTTATTAAGAGAGAGAAAAGGG - Intergenic
1104338156 12:127920259-127920281 TTCCATAAGGAGAGAGAAGAAGG + Intergenic
1106118965 13:26842017-26842039 CTCTCTTAAGAACGAGAAAATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106772590 13:32976210-32976232 TTCATTTAAGAGAGAGAAAATGG - Intergenic
1107052716 13:36069228-36069250 CTCTATTAAACTAGAGAAAAAGG + Intronic
1107772054 13:43797868-43797890 CTCTAAAAAGAGAGTGAAAATGG - Intergenic
1107933600 13:45326558-45326580 TTCTTTTAAGAGAGAAAAGATGG - Intergenic
1108570933 13:51750569-51750591 CTCTATTGGGTGAGAGAATAGGG - Intronic
1108739695 13:53322977-53322999 CTCTTTTCTGGGAGAGAAGAGGG + Intergenic
1108778381 13:53796042-53796064 CTCTAATAAGAAAAAGAAAAAGG + Intergenic
1109299549 13:60576930-60576952 TTCTATTAAGAGAGATAGGTGGG + Intergenic
1109337399 13:61009617-61009639 CTCTTTTAAAAGAGAGAAATTGG - Intergenic
1110005776 13:70266154-70266176 CCCTAATAAAAGAAAGAAGATGG + Intergenic
1111150094 13:84241654-84241676 CTCTCTAAAAAGAGAGAAAAAGG + Intergenic
1111931834 13:94520630-94520652 CTCTTTTTAGAGAGAAAGGAAGG - Intergenic
1112210414 13:97371629-97371651 CTCTAGGAAGAGTGAGCAGATGG + Intronic
1112372707 13:98808495-98808517 GTAAATTAAGAGAGAGAAAATGG + Intronic
1115172027 14:30519262-30519284 CCCTCTAAAGAGTGAGAAGAGGG + Intergenic
1115796691 14:36944745-36944767 CTCAATAAAATGAGAGAAGATGG - Intronic
1116125335 14:40776929-40776951 TTTTATTAAGTGAGAGATGAGGG + Intergenic
1116422895 14:44753456-44753478 CTCTATTGATAGAGAGATGAAGG - Intergenic
1116583260 14:46669731-46669753 CTCTGTTGAGAGAGAGAGGAGGG - Intergenic
1116691542 14:48113254-48113276 CTCAAATAATAGAGAAAAGAAGG - Intergenic
1118790192 14:69084139-69084161 CTCTAGTAGGTGAGAGAATAAGG - Intronic
1119172181 14:72544028-72544050 CACACTTAAGAGAGAGCAGAGGG - Intronic
1120473590 14:84958521-84958543 CTTTATAAAGAGACAGCAGATGG + Intergenic
1122106842 14:99464327-99464349 CTCTTTTAATAGAGAGCAAAGGG - Intronic
1122218997 14:100223230-100223252 CTCTATTAAAAGGGAGGAGGGGG + Intergenic
1122374305 14:101248149-101248171 CTATGTTAAATGAGAGAAGATGG + Intergenic
1122750643 14:103930060-103930082 CTTTTTAAAGAGCGAGAAGAGGG - Intronic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1124028818 15:25990665-25990687 CTTTAGTGAGAGAGAGAAAATGG - Intergenic
1126338025 15:47607806-47607828 TTCTTTAAAGAGAGAGAAGCTGG + Intronic
1126667152 15:51085779-51085801 CTTTATTTAGGGAGAGAGGAGGG - Intronic
1128070990 15:64796898-64796920 CTCTATTAAAAAAGAAAAGAGGG - Intergenic
1128421577 15:67496676-67496698 CTCTACTAAGAAGAAGAAGAAGG + Intronic
1130625855 15:85513802-85513824 GTCTATTAAGCAAGAGGAGAGGG - Intronic
1130727019 15:86449669-86449691 GTCTATTAAGAGTGTGGAGAAGG + Intronic
1130974785 15:88765768-88765790 TTCTATGGAGAGAGAGGAGACGG - Intergenic
1131324081 15:91425743-91425765 CACTAAAGAGAGAGAGAAGAGGG + Intergenic
1136076490 16:27820755-27820777 ATCTTCTAAGAGAGAGGAGATGG - Intronic
1137859343 16:51830554-51830576 CTCTTTGAAGAATGAGAAGAAGG - Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138848138 16:60592345-60592367 TTGTATTAAGTGAAAGAAGATGG + Intergenic
1139196207 16:64921241-64921263 GTCTAGTAAGAGAGAAAAGGAGG + Intergenic
1139562852 16:67754850-67754872 CTCTACAAAATGAGAGAAGAGGG + Intronic
1139591841 16:67937323-67937345 CCCTCTTGAGAGAGGGAAGATGG - Intergenic
1139611147 16:68059766-68059788 ATCCATTAAGAGTGAGATGAAGG - Intronic
1139729288 16:68928873-68928895 CACGATGAAGGGAGAGAAGAGGG - Intronic
1140241315 16:73203430-73203452 CTCTATTGAAAGAGAGAAGCAGG - Intergenic
1140330924 16:74056043-74056065 CTCTATTATGGGAGATAAAAAGG + Intergenic
1140997383 16:80274386-80274408 CTTTATAAACAGAGAGAAAAGGG - Intergenic
1142932461 17:3298677-3298699 CTCTATTATTAGGGAGCAGAAGG + Intergenic
1148800824 17:50224635-50224657 CTTTATTAACAGTGAGAAAATGG - Intergenic
1149662949 17:58345281-58345303 CTCTTTTTAGAGGGAGAACAAGG + Exonic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1150470062 17:65429694-65429716 CTCCATGAAGAGAAAGGAGAGGG + Intergenic
1151140831 17:71990733-71990755 TTCTAAAAAAAGAGAGAAGAAGG - Intergenic
1151343164 17:73484818-73484840 CTCTATTAAGAAAGAAAAGTGGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1154063319 18:11083874-11083896 TTCAATTAAGAGAAAGGAGAGGG + Intronic
1154195007 18:12259041-12259063 CTCGATTAAGAGAGTGACGCAGG - Intronic
1155066665 18:22274172-22274194 CTCTATTAAAAAGAAGAAGAAGG - Intergenic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1156811094 18:41252475-41252497 CTTTGATAAGAGAAAGAAGAAGG + Intergenic
1158064610 18:53391178-53391200 CCCTATTAAGTTAGAGAAGGAGG + Intronic
1158276428 18:55773231-55773253 ATCTATTAAGAAAGATTAGATGG - Intergenic
1159338293 18:67099802-67099824 CTCTAGTCTGAGAGAGTAGAGGG + Intergenic
1159362746 18:67426499-67426521 CTATATTGAGAGAGAATAGATGG + Intergenic
1159648095 18:70943404-70943426 TTCTTTTAAGAGAGAGAATCAGG + Intergenic
1160019971 18:75172811-75172833 TTGTGTTAAGAGGGAGAAGACGG + Intergenic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162519530 19:11171524-11171546 CTCTATTAAAAAAAAAAAGAAGG - Intronic
1163183060 19:15617564-15617586 ATCTATGGAGAGACAGAAGAGGG + Intronic
1164104702 19:22098809-22098831 CTCTGTAAAGAGGCAGAAGAAGG - Intergenic
1167615567 19:50531054-50531076 CACTTTTCAGAGAAAGAAGATGG + Intronic
1167695087 19:51010405-51010427 ATGTATTAAGAGAGAGCACAGGG - Intergenic
1168072565 19:53961092-53961114 CTATATGATGAGAGAGAAGTTGG + Intergenic
926427196 2:12749516-12749538 ATGTAATAAGAGAGAGAAAAGGG - Intergenic
926574249 2:14562930-14562952 CTGTATTAAGAGTGATATGATGG + Intergenic
927003218 2:18821442-18821464 CTCTAGAAGGAGAGAGGAGAAGG + Intergenic
927579324 2:24227462-24227484 GTCTATTAAAAGAAAGAATAAGG + Intronic
929141729 2:38672423-38672445 CTATTTTCAGAAAGAGAAGAAGG + Intronic
929309370 2:40404604-40404626 ATTTATTAAGAGAGAGAATATGG + Intronic
930432579 2:51298670-51298692 CTCTTGTAAGTGAGTGAAGAAGG + Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931256068 2:60573996-60574018 GTCAATTATGAAAGAGAAGATGG - Intergenic
931286285 2:60834688-60834710 CTCCATCCAGAGAGAGCAGAGGG + Intergenic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
931802563 2:65772823-65772845 CAATATTAAGAGAGTGATGATGG + Intergenic
932168930 2:69536023-69536045 ATCTATTAAGGGAGACAATAAGG - Intronic
932949987 2:76281693-76281715 CACAATTAAGAGAAAGATGAGGG - Intergenic
933009261 2:77037192-77037214 CTATATACAGAGAGAGAATATGG + Intronic
933233929 2:79843395-79843417 CTATATTAACATAGAAAAGAAGG - Intronic
935347463 2:102121685-102121707 CTTTGTTGAGAGAGAGAAAATGG - Intronic
935583933 2:104783937-104783959 CTCTTTTAAAAGAGAGAGAAAGG + Intergenic
936705949 2:115073959-115073981 CTCTGTAAAGAGTGAGAAGAAGG + Intronic
936934123 2:117821872-117821894 CTCTAGTAGGTGAGAGAATAAGG - Exonic
937036798 2:118788837-118788859 CTCTTATAAGAGAAAAAAGAGGG - Intergenic
937190246 2:120089141-120089163 CACTATTAAGACAGTAAAGATGG - Intronic
937395834 2:121533950-121533972 CTTTTGTAAAAGAGAGAAGAGGG + Intronic
937504538 2:122522322-122522344 CTCTAGAGAGAGGGAGAAGAGGG - Intergenic
939907575 2:147936306-147936328 CCCTATTAAGATGGGGAAGATGG - Intronic
939930820 2:148230944-148230966 CTCCATTTAAGGAGAGAAGAAGG - Intronic
940505863 2:154552160-154552182 CTATATTAAGTGTTAGAAGAGGG + Intergenic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
941641664 2:167995601-167995623 GAGTATCAAGAGAGAGAAGATGG + Intronic
944953083 2:204775618-204775640 CTGTATTATGACAGAGAAAATGG - Intronic
945104405 2:206296013-206296035 ATCTGTTAAGAGAGAGAACAGGG - Intronic
945400536 2:209376894-209376916 CTCACTTCAGAGAGAAAAGAAGG + Intergenic
946290095 2:218738109-218738131 CTCTTTTGAGGGAGAGAAAAAGG - Exonic
946656203 2:221950710-221950732 GACTTTTAAGAGTGAGAAGAAGG + Intergenic
947031772 2:225804416-225804438 ATGTATTAAGAGAGAGAAAATGG + Intergenic
947200923 2:227613920-227613942 CTCTATCAAGAGAGAGATTTGGG + Intronic
947308785 2:228777619-228777641 CTCTATTAGGCAAGAAAAGACGG + Intergenic
947387519 2:229606397-229606419 GTCTGTTTAGAGAGAGCAGAAGG + Intronic
947781443 2:232768630-232768652 CTCTATCAGGAAAGAGAAAATGG - Exonic
948437868 2:237966429-237966451 CACATTTAAGAGAGAAAAGAAGG + Intergenic
1169163122 20:3399506-3399528 CTCTACTAAGAAAGAAAAGGAGG - Intronic
1169284856 20:4299471-4299493 CATTATGAAGAGAAAGAAGATGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1172425056 20:34850348-34850370 CCCTATCCAGAGAGAAAAGAAGG - Intronic
1173027065 20:39317864-39317886 ATGTATAAAGAGAGAGAAAATGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173099717 20:40074371-40074393 GTCTTTTAAGAGAAAGAGGAAGG - Intergenic
1173117484 20:40259596-40259618 CTCTCAAAAGAGAGAGATGAAGG + Intergenic
1173315744 20:41941576-41941598 CTCTGTTCAGAGAGAGATGAAGG - Intergenic
1173501769 20:43559081-43559103 GACCATGAAGAGAGAGAAGAGGG + Intronic
1173513799 20:43650594-43650616 CTCTATTAAAAAAAAAAAGATGG + Intergenic
1174619317 20:51862202-51862224 CTCTATTTACAGAGAAAACAGGG + Intergenic
1174719551 20:52797375-52797397 CTCTATGAAGAGTGGGAAGGAGG + Intergenic
1175580467 20:60094890-60094912 CCCTGTTAAGAAAGAGAAAATGG - Intergenic
1177331528 21:19671135-19671157 CAATATTAAGAGAAACAAGAAGG + Intergenic
1177644516 21:23884675-23884697 CTCTCGTAAGAGAGAAATGAAGG - Intergenic
1177882751 21:26714125-26714147 CTCCACTAAAAGAGAGAACAGGG - Intergenic
1178787685 21:35668563-35668585 CTCTTTTCAGAGACAGGAGAAGG - Intronic
1179380228 21:40891753-40891775 CTCTAGAAAGAAGGAGAAGAGGG + Intergenic
1179965991 21:44806180-44806202 CAATATTAAGAGGGAGAAAAAGG + Exonic
1183239022 22:36642043-36642065 CCCTGCTGAGAGAGAGAAGAGGG + Intronic
1183548283 22:38467124-38467146 CGTTATTTAGAGAGAGATGAGGG + Intergenic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
951647657 3:24911175-24911197 CTTTCTTCCGAGAGAGAAGATGG - Intergenic
951805759 3:26642090-26642112 TTCTATTAAGCGAGACATGAAGG - Intronic
951831517 3:26933719-26933741 ATATATTGAGAGAAAGAAGATGG - Intergenic
951923158 3:27877741-27877763 CTATAAGAAGAGAGAGGAGATGG + Intergenic
952427532 3:33191023-33191045 CTCTATGAAGAGGGTGAAGAGGG - Intronic
952917757 3:38262181-38262203 CTCTATTAAGTGGGACAGGATGG + Intergenic
952983567 3:38757874-38757896 TCCTATTATGAGAGAGAGGAAGG - Intronic
953263717 3:41365248-41365270 CTCATTTAAGAAAAAGAAGAAGG + Intronic
953636074 3:44666062-44666084 CTCTATAAAGAGAAAAAACATGG - Intergenic
954541672 3:51397114-51397136 CTCCCTTAACAGAGAGAAGAGGG - Exonic
954597289 3:51837410-51837432 TTCTATTAAGGGACAGAACAAGG - Intergenic
954718792 3:52542172-52542194 CTCTATTAAAAGAAAAAAGAAGG + Intronic
955861371 3:63333940-63333962 CTGTATTAAGAATGAAAAGATGG + Intronic
956061487 3:65352563-65352585 CTCTATTAAAATGGGGAAGAAGG - Intergenic
956777126 3:72574666-72574688 ATCTATAAACAGAGAGAAGAGGG + Intergenic
957809472 3:85200927-85200949 TTGTATTAAGAGAGTGAAAATGG - Intronic
957977852 3:87470329-87470351 ATCTATTTAGAGACAGATGAAGG + Intergenic
958982003 3:100732313-100732335 TTCTAGTAACAGGGAGAAGAGGG - Intronic
959326104 3:104938350-104938372 CACAATTAAGAGGGAGAAGTGGG + Intergenic
960094671 3:113677783-113677805 CACTCTTAAAAGAGAGAAGTAGG - Intronic
960934462 3:122889098-122889120 CTCTATTCTGAGATAGAAAAGGG - Intergenic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
963206865 3:142645275-142645297 CCCTATTAAAAGACAAAAGAAGG - Intronic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
963624649 3:147655889-147655911 TTCCATTAAGAGAGAAAAAAAGG + Intergenic
963899915 3:150724323-150724345 GTCCACTGAGAGAGAGAAGAGGG - Intergenic
964064851 3:152564783-152564805 CATTAGTAAGAGAGAGATGAAGG - Intergenic
966391209 3:179454219-179454241 CTCTATTAAGAGAGCATAGTGGG + Intergenic
966618215 3:181935044-181935066 CTGGATGAAGAGAGAGAAGGGGG + Intergenic
967217061 3:187219898-187219920 CTCTTTAAAGAGAGTGAAAAGGG + Intronic
967343741 3:188429660-188429682 CTCTATTATGAAAGGGAAGACGG - Intronic
968010879 3:195273779-195273801 ATCTATTAAGTGAAAGAAGTGGG + Intergenic
970155480 4:13137424-13137446 CTCTAATAAGAAAGAGAGAAAGG + Intergenic
970823774 4:20251142-20251164 CTCTCTTATGAGAGAAAGGAGGG - Intergenic
970859853 4:20689452-20689474 CTGTTTTAAGAGAGAAAAAAAGG - Intergenic
970926534 4:21458884-21458906 CCATATTAAGAGAAACAAGAGGG - Intronic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
971856619 4:32053119-32053141 CTCTATTATGAGACAGAACTAGG + Intergenic
974380889 4:61138310-61138332 CTCTATCAGGAGACAGAAGTCGG - Intergenic
975519559 4:75285643-75285665 CACTATTGAGAGAAAGAAAAAGG + Intergenic
975558534 4:75688165-75688187 CTCTATTAAAAAAAAAAAGAAGG - Intronic
975995273 4:80306682-80306704 CTCTATTGAGACAGATATGAGGG + Intronic
976611650 4:87036701-87036723 ATCTATTAAGAGAAACAAAATGG + Intronic
977444431 4:97111424-97111446 GTCTATTCAAAGTGAGAAGATGG + Intergenic
977909029 4:102510811-102510833 CTATATTTGGAGGGAGAAGAAGG + Intronic
978085467 4:104646816-104646838 ATCTGTTAATAGAGAGTAGAAGG + Intergenic
978385031 4:108169534-108169556 AACTATTAAGAGAGAACAGAAGG + Intergenic
978686604 4:111452705-111452727 CTCTATTTAGAGAGAGATCCTGG + Intergenic
978729202 4:112005094-112005116 CAATATTAAGAGAGACAACAGGG + Intergenic
979067231 4:116153359-116153381 GTCAATTAAGAAAGAGAAGAAGG + Intergenic
979763159 4:124432229-124432251 CTATCTTAACAGAGAGAAGCAGG - Intergenic
980646125 4:135644329-135644351 CTCTGCTAAGACAGTGAAGAAGG + Intergenic
981051651 4:140315122-140315144 CTCACTGAAGAGAGAGAATATGG - Intronic
981568625 4:146128667-146128689 CTATCTTAAGAGAGAGGATAAGG - Intergenic
981780269 4:148421398-148421420 CTATATTAAGACAGAAAACATGG - Intronic
981813459 4:148801957-148801979 CTATAATAAGAGAGAGAAAGGGG - Intergenic
982272244 4:153602746-153602768 CTCTACTCAGTGAGAGAACAAGG - Intronic
982781859 4:159499731-159499753 CTCTTTTAATAGAAAGATGATGG - Intergenic
983228807 4:165109754-165109776 CTCATTTAGGCGAGAGAAGAAGG - Intronic
984292518 4:177813324-177813346 TTCCATTAAGAAAGAGAAGATGG - Intronic
985182666 4:187281867-187281889 CCCTATTAAGGGAGATAACAGGG + Intergenic
988031138 5:25764248-25764270 CTTTATTAAGAGACAGAAAAAGG + Intergenic
989050043 5:37310471-37310493 CTATATTAAGTGAAACAAGATGG + Intronic
989471960 5:41830343-41830365 TTCTTTTAAGAGAAAGAAAAAGG - Intronic
989596131 5:43157869-43157891 CATTATGAAGACAGAGAAGATGG - Intronic
989748677 5:44864087-44864109 TTATATTAAGAGAGAGGAAAGGG + Intergenic
990334262 5:54756720-54756742 CTATATTAAAAGCTAGAAGAAGG + Intergenic
993161018 5:84290996-84291018 CTCTACTAAGCCAGAGAAGTTGG + Intronic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994614531 5:102087315-102087337 CTCTTTTAAGAAAGAGAAAAAGG - Intergenic
995320742 5:110830852-110830874 CTCCATCAGCAGAGAGAAGAGGG - Intergenic
995330451 5:110940287-110940309 CACTATCAAGAGAGTGAAGTCGG - Intergenic
996701376 5:126453328-126453350 TTCTTTTAAGATGGAGAAGATGG - Intronic
997577051 5:134987438-134987460 CTCTACCAAGAAATAGAAGAGGG + Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
998695912 5:144639358-144639380 TTTTATAGAGAGAGAGAAGAAGG + Intergenic
998871139 5:146553217-146553239 CTTTATAAAGACAGAAAAGAAGG + Intergenic
999854882 5:155583421-155583443 CTCTGTAAAATGAGAGAAGAGGG - Intergenic
1000674607 5:164105547-164105569 CTCTACTAAGGGAGGGCAGAGGG + Intergenic
1002110619 5:176908158-176908180 ATATATTGAGAGAGAGAAGGGGG + Intronic
1003924884 6:10868480-10868502 CTCTTTCAAAAGAGAGAAGGAGG - Intronic
1004386922 6:15181133-15181155 CTCAAAAAAGAGAGAGAAAATGG + Intergenic
1005034452 6:21542876-21542898 GTCTACTTAGAGAGACAAGACGG - Intergenic
1006569333 6:34987700-34987722 CTGTTTTAAGAGAGAGATTATGG + Intronic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1007876979 6:45114706-45114728 ATCTATTAAGAGTTTGAAGATGG - Intronic
1009627833 6:66159992-66160014 CTCTTTTAAGTAAGAGAGGAAGG - Intergenic
1009792401 6:68420180-68420202 CTCTACTAAGGCAGTGAAGAGGG + Intergenic
1010360469 6:74987293-74987315 CTCTATTAGGACAGTGCAGAGGG + Intergenic
1011219980 6:85044062-85044084 TGCTATTTAGAGAGAGAAAAAGG - Intergenic
1012420218 6:99056640-99056662 CTCCCTAAAGAGAGAGATGAAGG + Intergenic
1012618147 6:101303224-101303246 CTCTATTAAAATAAAGAAAAGGG - Intergenic
1012716408 6:102678289-102678311 CTTTATGAATAGGGAGAAGATGG - Intergenic
1012949488 6:105503051-105503073 GTTTAGTAAGGGAGAGAAGAAGG - Intergenic
1015391848 6:132691326-132691348 CCCTGTTAAGTGAGATAAGATGG + Intronic
1016011664 6:139143463-139143485 CTATGATAAGAAAGAGAAGATGG - Intronic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016277515 6:142372309-142372331 CTCAATTAAAAAGGAGAAGAAGG + Intronic
1017035289 6:150261856-150261878 CTCTATGGAGAGAGAGGAAAGGG - Intergenic
1017161840 6:151372657-151372679 CTGTTTTAAGATAGAAAAGAGGG + Intronic
1017373219 6:153736989-153737011 CGCTATTGCAAGAGAGAAGACGG + Intergenic
1017416269 6:154224345-154224367 GTCACATAAGAGAGAGAAGATGG - Intronic
1018142565 6:160853822-160853844 CACTATCGTGAGAGAGAAGACGG - Intergenic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018425991 6:163681213-163681235 CTCCATTGAGAGAGACAAGTTGG + Intergenic
1018779515 6:167049873-167049895 ATCTAAAAAGAGAGAGAATAAGG - Exonic
1019358161 7:591681-591703 CTCTATTAACAGAAAAAAAAAGG + Intronic
1019773268 7:2896968-2896990 CGCAATTCAGAGAGAGAGGAGGG - Intergenic
1020390325 7:7650971-7650993 CTCTTTTAAGAGAGCAAATATGG - Intronic
1020760912 7:12267825-12267847 CTCTATTTAAAGGGGGAAGAGGG - Intergenic
1021316009 7:19147872-19147894 CTCTGTTGAAAGAGAGAAGGAGG - Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022984917 7:35643109-35643131 CTCTAATAATAGAGAGAAACTGG + Intronic
1024383183 7:48722806-48722828 CTCTATTAGGACAGTGCAGAGGG - Intergenic
1024984471 7:55183182-55183204 CTTTATTAAGAGAAAGGAGAGGG - Intronic
1025027809 7:55532536-55532558 CTCTATGGAGAGTGAGAATATGG + Intronic
1026222554 7:68413175-68413197 AACTGTTAAGAGAGAGAAGGGGG + Intergenic
1027153621 7:75750816-75750838 CTCGATTAGAAGAGAGAAGGGGG + Intergenic
1027934037 7:84579621-84579643 CAATATGAAGAGAGAGAAAAAGG + Intergenic
1028041946 7:86063958-86063980 CTCTACTAGGAGAGTGCAGAAGG + Intergenic
1029341523 7:99948694-99948716 CTCCAGGAAGAGAGATAAGAAGG + Intergenic
1030191149 7:106811582-106811604 ATCTTTAAAGAGAGAGAACATGG - Intergenic
1030857387 7:114577635-114577657 CTCTCTTAAGAGAGATCAGGAGG - Intronic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1031393332 7:121242834-121242856 GTATATTAAGAGAGAGAAACTGG - Intronic
1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG + Intergenic
1031647356 7:124242489-124242511 CTTTGTTGAGAGAAAGAAGAAGG + Intergenic
1033086975 7:138351753-138351775 TTAAATTAAGAAAGAGAAGATGG - Intergenic
1033584461 7:142763749-142763771 CTGTATGAAGAGAGAGAAAGAGG - Intronic
1034144057 7:148852797-148852819 CTGTATTAAGAAAAAAAAGATGG - Intronic
1034154224 7:148941327-148941349 CTCTCTTAAGAGAGAGCATTTGG + Intergenic
1035664131 8:1367866-1367888 AACTGGTAAGAGAGAGAAGAGGG + Intergenic
1035938760 8:3872705-3872727 CTCTGTTAATAGTGAGAACAAGG - Intronic
1036463742 8:8977053-8977075 ATATATTAAGAGAGAAAATATGG + Intergenic
1036711734 8:11083806-11083828 ATGTATTAAGAAAGAGAACATGG + Intronic
1037680635 8:21094632-21094654 CTGTATTATGTGAGAGAAGTAGG - Intergenic
1038754861 8:30331039-30331061 CACTCTTAAGAGGAAGAAGAAGG - Intergenic
1040122186 8:43695716-43695738 CCCTATTAAGTGGGAGGAGAAGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041423108 8:57691786-57691808 CTTTAGCAAGAAAGAGAAGAGGG + Intergenic
1041467475 8:58171383-58171405 ATATTTTAAGAGAGAAAAGAAGG - Intronic
1041824730 8:62081470-62081492 CACTATTAATAGACAGAAAAAGG - Intergenic
1041955448 8:63554005-63554027 CTCTACTAAGATAGGGTAGAAGG - Intergenic
1042251449 8:66759884-66759906 TCCTTTTAAGAGACAGAAGAGGG - Intronic
1042348723 8:67754124-67754146 CTCTCTTGAGTGAGAGATGATGG + Intergenic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1043098897 8:76014436-76014458 GACTTTTAGGAGAGAGAAGAAGG - Intergenic
1043951782 8:86317497-86317519 TTCTCATTAGAGAGAGAAGATGG - Intronic
1044662244 8:94602876-94602898 AGAGATTAAGAGAGAGAAGATGG - Intergenic
1045817661 8:106295303-106295325 CTCTATTAAAAGAGAGCAACTGG + Intronic
1045943900 8:107772763-107772785 CTGTATCAAGAATGAGAAGATGG + Intergenic
1046783761 8:118243869-118243891 CTGCATGAAGAGAGAGAAAATGG + Intronic
1047621629 8:126613517-126613539 CTCACTTAAGACAGAGAAAATGG + Intergenic
1047954552 8:129963589-129963611 CTCTATTCAGGCAGTGAAGATGG + Intronic
1050875068 9:10623687-10623709 CTCTATTAAGGCAGTGCAGAGGG - Intergenic
1051058591 9:13018366-13018388 CTCTATTAAGAGAGAATATATGG + Intergenic
1051441849 9:17093060-17093082 CTAAATTAAGAGTGAGAAGAAGG - Intergenic
1052015025 9:23453339-23453361 TGCTTTAAAGAGAGAGAAGAGGG + Intergenic
1052626950 9:30987770-30987792 CTTTATTCAGAGAGTAAAGATGG - Intergenic
1055739028 9:79365297-79365319 CACCTTTAAAAGAGAGAAGATGG + Intergenic
1057189724 9:93079953-93079975 GTGTATTAAGAGAGAGAGAAAGG - Intronic
1057874068 9:98740103-98740125 CTCTACTAAGAGTGAAAAGGGGG + Intronic
1058367647 9:104229322-104229344 CTCTATTAAGATTGGGAATAAGG + Intergenic
1058394815 9:104539251-104539273 CTTTAAGAAGAGAGAGAAGGAGG + Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1058501845 9:105627270-105627292 CACTATTAAGAGAGTAAAGAAGG - Intronic
1059072026 9:111147700-111147722 CCCTATTAAGATATAGAACATGG - Intergenic
1059081671 9:111256653-111256675 CTATGTTGAGAGAGAGAGGATGG - Intergenic
1059469747 9:114495771-114495793 TTCTCTAAAGAGAAAGAAGAGGG + Intronic
1059995967 9:119909800-119909822 CTCTAAAAGGACAGAGAAGATGG + Intergenic
1060386027 9:123229347-123229369 CTCAATAAAGAAATAGAAGAGGG + Intronic
1061488226 9:130931054-130931076 CTCTGTGAAGAGATAGAGGAAGG - Intronic
1185895408 X:3854167-3854189 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1185900525 X:3892591-3892613 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1185905641 X:3931022-3931044 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1186538632 X:10375996-10376018 TTCTATAAAAAGGGAGAAGAAGG + Intergenic
1186673773 X:11794284-11794306 CACTAGTAAGAGAGAGAGGAGGG - Intergenic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187956851 X:24527598-24527620 CTCTATGAAGACAGAAAAGAGGG + Exonic
1188391521 X:29626634-29626656 TTCTAAAAAGAGAGAGAAGAAGG + Intronic
1188714234 X:33441545-33441567 CTCTCTCAAGAGAAAGGAGAAGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190795381 X:53736330-53736352 ATACATTTAGAGAGAGAAGAGGG - Intergenic
1193226045 X:78985528-78985550 CTCTACTAAGACAGTGAGGAGGG - Intergenic
1193299958 X:79878333-79878355 GTCTAAAATGAGAGAGAAGAGGG + Intergenic
1193524294 X:82570366-82570388 CTAAATTAAGACAGAAAAGAAGG - Intergenic
1195789461 X:108566966-108566988 CTCAATAGAGAGAGAGATGAGGG - Intronic
1197080776 X:122412788-122412810 CTCCATTCAGAGGGAGAAAAAGG - Intergenic
1197263509 X:124341660-124341682 CTCTATAAAGGGAAAAAAGAGGG + Intronic
1197495266 X:127172078-127172100 CTCAAACAAGAGAGAGAAAAGGG + Intergenic
1199733540 X:150661737-150661759 CTATAGTAACAGAGAGTAGAAGG + Intronic
1201686133 Y:16704585-16704607 ATCTTTTGAGAGAGAGAAAATGG + Intergenic