ID: 997605189

View in Genome Browser
Species Human (GRCh38)
Location 5:135170202-135170224
Sequence CCCCCTCGAAGGAGAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997605189_997605192 -10 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605192 5:135170215-135170237 TTCGAGGGGGTCACTTTGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
997605189_997605195 4 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605195 5:135170229-135170251 TTTGAGAGGAGGTGAGCCCTGGG 0: 1
1: 0
2: 3
3: 14
4: 190
997605189_997605199 15 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605199 5:135170240-135170262 GTGAGCCCTGGGGATACCTGGGG 0: 1
1: 1
2: 6
3: 54
4: 332
997605189_997605197 13 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605197 5:135170238-135170260 AGGTGAGCCCTGGGGATACCTGG No data
997605189_997605194 3 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605194 5:135170228-135170250 CTTTGAGAGGAGGTGAGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 228
997605189_997605196 5 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605196 5:135170230-135170252 TTGAGAGGAGGTGAGCCCTGGGG No data
997605189_997605198 14 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605198 5:135170239-135170261 GGTGAGCCCTGGGGATACCTGGG 0: 1
1: 2
2: 2
3: 30
4: 282
997605189_997605193 -7 Left 997605189 5:135170202-135170224 CCTGCAGTTCTCCTTCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 997605193 5:135170218-135170240 GAGGGGGTCACTTTGAGAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997605189 Original CRISPR CCCCCTCGAAGGAGAACTGC AGG (reversed) Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900928029 1:5718294-5718316 CCTTCTGGAAGGAGAGCTGCCGG - Intergenic
901738050 1:11324762-11324784 CCCCCACACAGGAGAACTGTTGG + Intergenic
915537916 1:156548649-156548671 ACCCCTCGAAGGGCCACTGCGGG + Exonic
916056753 1:161073469-161073491 CACCCTGGAAGCAGAACTGATGG + Intronic
919057311 1:192587107-192587129 CCTTCTAGAAGGAGCACTGCTGG + Intergenic
922795545 1:228337806-228337828 CCCCCTCCACGCAGAACAGCGGG - Intronic
1062804526 10:407443-407465 ACACCCCGAAGCAGAACTGCTGG + Intronic
1063184443 10:3638036-3638058 TCCCATCGAAGGAGGATTGCAGG - Intergenic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1068977085 10:63021790-63021812 CCCCCTCCTTGCAGAACTGCTGG + Intergenic
1071508656 10:86247814-86247836 CCTCCTTGAAGGAGGAGTGCTGG - Intronic
1074442116 10:113487181-113487203 GCCCCTCCATGGGGAACTGCAGG - Intergenic
1080729307 11:34932718-34932740 ATCCCTCGAAGTAGAGCTGCTGG - Intronic
1083887415 11:65579589-65579611 CCTCCTCCAAGGAGACCTCCTGG - Intronic
1083925389 11:65803129-65803151 CCCACTCGAAGGTGACCTTCTGG - Intergenic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1089709784 11:120306612-120306634 CCCCCCCGGTTGAGAACTGCCGG + Intronic
1095366925 12:41418699-41418721 TCTCCTCCAAGGAGGACTGCAGG - Intronic
1101755872 12:107620242-107620264 CCCACTCAAAGGGGAACAGCAGG - Intronic
1101973140 12:109331581-109331603 CACCCTGGAAGGAGGACTTCGGG + Intergenic
1102949514 12:117020977-117020999 CCTCCTCGAAGTGGAATTGCCGG + Intronic
1104664086 12:130635087-130635109 AACCCTGGAAGGAGAACGGCAGG - Intronic
1104950351 12:132437188-132437210 TCCCCTGGAGGGAGAAATGCGGG + Intergenic
1105602092 13:21896665-21896687 CCCCCCCAAAGCAGAAATGCTGG + Intergenic
1106523779 13:30521727-30521749 ATCCCTAGAAGTAGAACTGCTGG + Intronic
1112033524 13:95477464-95477486 CCCCCTGGAAGGAGTCCTCCGGG - Intronic
1114696699 14:24632794-24632816 CACCCTCTAAGGAGACCTCCTGG + Intronic
1116740420 14:48747294-48747316 CCCCCTAGAAGGAGAGAGGCTGG - Intergenic
1121917470 14:97848874-97848896 ACCTCTGGAAGGAGACCTGCAGG - Intergenic
1124089050 15:26580355-26580377 GCTCCACGATGGAGAACTGCGGG + Exonic
1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG + Intronic
1128253749 15:66182110-66182132 CCCCCTCTAAGGACAACAGCAGG + Intronic
1130579859 15:85126320-85126342 CCCACTCGATGCAGTACTGCAGG - Exonic
1132850501 16:2022925-2022947 CCCCGCCGAAGGAGGACTCCAGG + Intergenic
1133827797 16:9294227-9294249 CCCACTTGAAGCAGAACTGAAGG + Intergenic
1137376290 16:47954966-47954988 CGGCCTCGAATGAGGACTGCTGG - Intergenic
1138481418 16:57305767-57305789 CACCCTAGAAGGAGAACCCCAGG + Intergenic
1141530112 16:84640517-84640539 CCCAAGCGAAGGAGGACTGCAGG - Intergenic
1144506123 17:15832752-15832774 CCCACTAGAACTAGAACTGCTGG + Intergenic
1145118107 17:20230901-20230923 CCCACTAGAACTAGAACTGCTGG + Intronic
1145170296 17:20650682-20650704 CCCACTAGAACTAGAACTGCTGG + Intergenic
1148139724 17:45319486-45319508 CCCTCTGGAAGGAGAGCTTCGGG + Intergenic
1150272039 17:63872968-63872990 CCCCCACCAAGAAGGACTGCTGG + Intronic
1150275586 17:63895864-63895886 CCCCCACCAAGAAGGACTGCTGG + Intronic
1153285868 18:3453232-3453254 CCAGCTCAAAGGAGAACTTCTGG + Intronic
1153992345 18:10411635-10411657 CCACCTAGAAGGCAAACTGCAGG + Intergenic
1155377110 18:25172012-25172034 CCCCCCCAAAAGAGAACTGCAGG - Intronic
1157392307 18:47312966-47312988 CTCCCTGAAAGGAGGACTGCTGG + Intergenic
1161888051 19:7012147-7012169 CCCCCTTCAAGGAGAATTGGAGG - Intergenic
1166700146 19:44877661-44877683 CCCCCTCGGGGGAGGACAGCTGG - Intronic
1167471804 19:49679754-49679776 CCACCAAGAAGGAGAATTGCTGG + Intronic
925477316 2:4231951-4231973 CCCCTGGGCAGGAGAACTGCTGG - Intergenic
926089222 2:10039496-10039518 CCACCTGGAAGGATAACTACAGG - Intergenic
1169830536 20:9820440-9820462 CCTCCTCCAAGGAGAAATGAAGG + Intronic
1173598906 20:44279087-44279109 CCCTCTCAAAGAAGGACTGCAGG - Exonic
1173642357 20:44612785-44612807 ATCCCTAGAAGTAGAACTGCTGG - Intronic
1176173999 20:63709143-63709165 GCCGCTTTAAGGAGAACTGCAGG + Exonic
1176243807 20:64087906-64087928 CTCCCACGGAGGAGAACTGGTGG - Intronic
1176266824 20:64213807-64213829 CCCCCCAGGAGCAGAACTGCGGG + Intronic
1179486564 21:41714225-41714247 CCCACTCACAGGAGAGCTGCTGG + Intergenic
1179575869 21:42308166-42308188 CCCCCAAGAAGGAGGACTGAGGG + Intergenic
1180098310 21:45571971-45571993 CTCCCTGGAAGGAAAGCTGCAGG - Intergenic
1182562926 22:31175618-31175640 AACCCTAGAAGTAGAACTGCAGG - Intronic
1183829008 22:40408270-40408292 CCCCCGCGATGGAGTACTGATGG - Exonic
951563415 3:23989579-23989601 CCCCATGGATGGAGAATTGCCGG + Intergenic
959967705 3:112375563-112375585 CCCCCTCGAAGGACATATGATGG + Intergenic
962258358 3:133887235-133887257 CCTCCTGGAAGCAGAAGTGCAGG + Intronic
966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG + Intronic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967299630 3:188000405-188000427 CCCCCTCTCAGGGGCACTGCAGG - Intergenic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
969216089 4:5723525-5723547 CCCCCTTGAAGGTCAACTCCTGG + Intronic
969689930 4:8698774-8698796 CCCCCTGGCAGGGGAGCTGCTGG - Intergenic
971340977 4:25768559-25768581 CCCCCACAAGGGAGAACTGTAGG - Intronic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
979233806 4:118376504-118376526 CCCCCTTGGAGAAGAACTCCAGG - Intergenic
986569923 5:9154282-9154304 CCTCCTCTGAGGAGAACTGGTGG + Intronic
992568418 5:78025765-78025787 CCTCCTAGAACAAGAACTGCAGG - Intronic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
999113280 5:149140780-149140802 CCCCGTCTGAGGAGAACAGCAGG - Intergenic
999388408 5:151172285-151172307 TTCCTTAGAAGGAGAACTGCTGG - Intergenic
1004527398 6:16422139-16422161 CCCTCTCGAAGGATAACAGTTGG - Intronic
1006059728 6:31411136-31411158 CCCCATCGTAGTAGAAATGCTGG - Exonic
1006072219 6:31506207-31506229 CCCCATCGTAGTAGAAATGCCGG - Exonic
1007794794 6:44338802-44338824 TCTCCTCGAAAGAGCACTGCAGG - Intronic
1008673962 6:53799778-53799800 CCCCCTAGAAACAGAACTTCTGG - Intronic
1013507332 6:110814334-110814356 CCCCTTCGAAGGAGACCTGATGG - Intronic
1015207870 6:130661159-130661181 CTCCCTGGAAGGAGAACTCATGG - Intergenic
1016014073 6:139166402-139166424 CCCACTCGTAGAAGCACTGCAGG - Exonic
1018865344 6:167742974-167742996 CCCCCTGGAATGAGAACTTCTGG - Intergenic
1019493223 7:1324646-1324668 CCTCCTCCAGGGAGAACTCCTGG - Intergenic
1022843232 7:34184534-34184556 CCTCCTCCAAGGAAAGCTGCTGG + Intergenic
1026595012 7:71727128-71727150 TCCACTCAAAGGAGAACAGCTGG + Intergenic
1032163875 7:129530749-129530771 ACCCCTAGAAGGGGAATTGCTGG - Intergenic
1032398000 7:131604560-131604582 CCCCCTCCAAGGGGAAAAGCTGG - Intergenic
1034549198 7:151809538-151809560 CCCCCTCCAAGGATACCTCCAGG + Intronic
1037514512 8:19617286-19617308 CCCCATAGAAGGTGAACGGCAGG - Intronic
1038704957 8:29884835-29884857 CCCCCAGCAAGGAGATCTGCTGG + Intergenic
1046057737 8:109098459-109098481 CACCCTGGAAGAAGAACTGGAGG - Intronic
1050290316 9:4147663-4147685 CTCCCTTCAAGGGGAACTGCTGG + Intronic
1057582963 9:96303752-96303774 CACCCTAGAAGCAGAATTGCTGG + Intergenic
1060202681 9:121660959-121660981 CACCCACGAAGGAGAAGTCCAGG + Intronic
1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG + Intergenic
1061191446 9:129085016-129085038 CCCCAAGGAAGGAGATCTGCTGG - Exonic
1203759468 EBV:4577-4599 CCCACTCGACCGAGGACTGCCGG - Intergenic
1190879070 X:54479828-54479850 GCCCCTTGAATGTGAACTGCAGG + Intronic