ID: 997605678

View in Genome Browser
Species Human (GRCh38)
Location 5:135174243-135174265
Sequence CTCTTAACACAGAAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997605678_997605689 -1 Left 997605678 5:135174243-135174265 CCCAGCCTCTTCTGTGTTAAGAG 0: 1
1: 0
2: 3
3: 24
4: 227
Right 997605689 5:135174265-135174287 GCAAGGGAGGGGTTGGGGAGAGG 0: 1
1: 0
2: 14
3: 226
4: 2262
997605678_997605686 -8 Left 997605678 5:135174243-135174265 CCCAGCCTCTTCTGTGTTAAGAG 0: 1
1: 0
2: 3
3: 24
4: 227
Right 997605686 5:135174258-135174280 GTTAAGAGCAAGGGAGGGGTTGG 0: 1
1: 0
2: 1
3: 29
4: 364
997605678_997605687 -7 Left 997605678 5:135174243-135174265 CCCAGCCTCTTCTGTGTTAAGAG 0: 1
1: 0
2: 3
3: 24
4: 227
Right 997605687 5:135174259-135174281 TTAAGAGCAAGGGAGGGGTTGGG 0: 1
1: 0
2: 2
3: 30
4: 293
997605678_997605688 -6 Left 997605678 5:135174243-135174265 CCCAGCCTCTTCTGTGTTAAGAG 0: 1
1: 0
2: 3
3: 24
4: 227
Right 997605688 5:135174260-135174282 TAAGAGCAAGGGAGGGGTTGGGG 0: 1
1: 0
2: 3
3: 40
4: 495
997605678_997605690 5 Left 997605678 5:135174243-135174265 CCCAGCCTCTTCTGTGTTAAGAG 0: 1
1: 0
2: 3
3: 24
4: 227
Right 997605690 5:135174271-135174293 GAGGGGTTGGGGAGAGGAATCGG 0: 1
1: 1
2: 15
3: 144
4: 1241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997605678 Original CRISPR CTCTTAACACAGAAGAGGCT GGG (reversed) Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
906139236 1:43523743-43523765 CTCTTATGGAAGAAGAGGCTGGG + Intergenic
907622636 1:55996963-55996985 CTCTAAGCACAGGAAAGGCTGGG - Intergenic
907673131 1:56494013-56494035 CTCTAAAAACAGAAAAGGCAAGG + Intergenic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
912003305 1:104860817-104860839 CTCTTCAGACAGAATTGGCTGGG - Intergenic
914243559 1:145869475-145869497 CTCCAAACACAAAACAGGCTGGG - Intronic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
915188348 1:154126271-154126293 CTAAGAACACTGAAGAGGCTTGG - Intronic
915753215 1:158232281-158232303 CTCCCAGCACAGAAAAGGCTGGG + Intergenic
917510313 1:175664064-175664086 CTCCTAACACAGAAGTGACCAGG - Intronic
918179305 1:182072445-182072467 TTCTTAACACTGAAGGGGTTAGG - Intergenic
922699271 1:227749114-227749136 ATCCAAACACAGAAGATGCTCGG - Intronic
1065078257 10:22102396-22102418 CTATTAAAATAAAAGAGGCTGGG + Intergenic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1067327378 10:45282114-45282136 CCCCTAACACAGCAGAAGCTAGG + Intergenic
1067686778 10:48470537-48470559 CTCTATACCCAGAAGAGGCCAGG + Intronic
1072211903 10:93253933-93253955 GTATTAAAACAGAAGAGACTAGG - Intergenic
1075326689 10:121538348-121538370 CACTTTACACAGATGACGCTTGG + Intronic
1075913841 10:126149047-126149069 CTCTTTACAGGGAAGAGGGTGGG - Intronic
1077012864 11:386640-386662 CTCTCAGCAGAGAGGAGGCTGGG - Intergenic
1078360617 11:10664945-10664967 TTCTCAAAACAGAAAAGGCTGGG - Intronic
1083354139 11:62053135-62053157 CCCCTAACACAGGAGAAGCTAGG - Intergenic
1083857225 11:65399292-65399314 CTCAAAACTGAGAAGAGGCTGGG - Intronic
1084473280 11:69375322-69375344 CTCTTACTCCAGAAGAGGATGGG + Intergenic
1084960951 11:72716364-72716386 CTCTTCACACAGAAGAGGAAAGG - Intronic
1085479024 11:76806426-76806448 CTGTGAAGACGGAAGAGGCTGGG + Intergenic
1087224751 11:95586127-95586149 CTCTAGACACAGAACAGGGTAGG + Intergenic
1087477481 11:98654822-98654844 CTCCCAACATAGAAGAAGCTAGG + Intergenic
1087720500 11:101659866-101659888 CTCTTAGCACAGAAAAGTCCAGG - Intronic
1087721972 11:101676621-101676643 TTCTGAACTGAGAAGAGGCTGGG + Intronic
1087789636 11:102392533-102392555 CTTTTAAGAGAGAACAGGCTGGG - Intergenic
1091002786 11:131924476-131924498 CTCTAAATTCAAAAGAGGCTGGG - Intronic
1091520289 12:1233108-1233130 CTCTACACACAGAAGAGACCAGG + Intronic
1091598653 12:1901704-1901726 CTCTCAGCAAAGAAAAGGCTGGG + Intronic
1093148746 12:15597593-15597615 CTCTTGTCACTGAAAAGGCTTGG + Intergenic
1094165827 12:27442551-27442573 CTCTTATCAAAGAAAAGCCTAGG + Intergenic
1094581755 12:31739870-31739892 CTCTTCACACAGAAGAGTCTGGG - Intergenic
1095247478 12:39939658-39939680 GTCTTAACATATAAGAAGCTAGG + Intronic
1097867015 12:64567397-64567419 CACTTAACACAAGGGAGGCTGGG - Intergenic
1098396530 12:70024530-70024552 CTCCCAACAAAGAAAAGGCTGGG + Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1101164364 12:102012971-102012993 TTTTTAACATAGAAGAAGCTTGG + Exonic
1101962781 12:109262336-109262358 CCCTTAAAAGAGAAGAGGCAGGG - Exonic
1103636570 12:122312106-122312128 ACCTTGACACAGAAGAGACTAGG + Intronic
1103786922 12:123439618-123439640 CTCTTAAGAAAAAATAGGCTGGG - Intergenic
1104526349 12:129526576-129526598 TTCTAAAGAAAGAAGAGGCTGGG - Intronic
1105871690 13:24511244-24511266 CTGTTAACCCAGAAGAGGGCTGG - Intronic
1106626628 13:31427286-31427308 CTTAGAACACAGAAGAGCCTGGG - Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1109933985 13:69256921-69256943 CTCTGAACAAAGAAAAGCCTAGG + Intergenic
1110763730 13:79258696-79258718 GGCTTAACACAGAAGCGGCAGGG - Intergenic
1110975386 13:81827023-81827045 CTTTTGACCCAGAAGAGCCTGGG - Intergenic
1112219813 13:97476567-97476589 CTCCTACCACTGAAGAGGTTAGG + Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1112402586 13:99088282-99088304 CTCTTAGGACAGAAGAGGTCTGG - Intergenic
1113258376 13:108532496-108532518 TTTTTAAAACAAAAGAGGCTGGG + Intergenic
1114460351 14:22882672-22882694 CTCTTAGCCCAGAAGAGGCAGGG + Intergenic
1115925115 14:38424531-38424553 CTATCAACAAAGAAGAGCCTGGG - Intergenic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118444843 14:65841438-65841460 CTCTTCACTCAGAAGAAGCCTGG - Intergenic
1118458507 14:65966698-65966720 CTGATAACACAGAAGAGCCCTGG + Intronic
1119084112 14:71723960-71723982 CTCTTACAACAAAAGAGGCCGGG + Intronic
1119697184 14:76722182-76722204 CTTCTAGCGCAGAAGAGGCTGGG - Intergenic
1120181504 14:81347436-81347458 CTCTTAACAAAGAAAAGCCCAGG + Intronic
1121375617 14:93407589-93407611 CTCCTAACACAGATAAGGCCTGG - Intronic
1121485756 14:94313197-94313219 CTCATGAGACAGAAGAGGCCTGG + Intronic
1125991247 15:44110605-44110627 CTCTTAACACAGAAAAAGTGTGG + Intronic
1126578145 15:50217758-50217780 CTCAAAAAACAGAAGAGGCCAGG + Intronic
1128523601 15:68391614-68391636 GTGTTATCACAGAAAAGGCTTGG + Intronic
1129070878 15:72950399-72950421 CTCTCAACAAAGAAAAGCCTAGG + Intergenic
1129360754 15:75022448-75022470 CACCTAAAATAGAAGAGGCTTGG + Intergenic
1133375914 16:5287007-5287029 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1134460593 16:14426320-14426342 CTCTTAAAAAAAAAGAGGCCGGG + Intergenic
1134903484 16:17959619-17959641 CTCAGGAGACAGAAGAGGCTAGG + Intergenic
1136060660 16:27724136-27724158 CTCTGAGCACACAAGAGGCCAGG - Intronic
1136996471 16:35194187-35194209 CTCCCAACACAGGAGAGACTTGG - Intergenic
1139290042 16:65849718-65849740 CTCTAGACACAAGAGAGGCTGGG - Intergenic
1140943928 16:79749696-79749718 CCCTTGGCACAGAAGAGGATGGG - Intergenic
1141564770 16:84893791-84893813 CTCTGCACAAAGCAGAGGCTGGG + Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145808767 17:27752601-27752623 CTCTTGAGAGAGAGGAGGCTGGG - Intergenic
1146012608 17:29207739-29207761 CTCTCCACAGAGCAGAGGCTGGG + Intergenic
1146286997 17:31580944-31580966 CTCAGAACACTCAAGAGGCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146576565 17:33998017-33998039 CTCAGAACAAAGAAGAGCCTGGG - Intronic
1147464334 17:40599155-40599177 CTATTTACACAGAAGTGCCTCGG - Intergenic
1148634690 17:49139519-49139541 CTCTAAAAACATAATAGGCTGGG - Intronic
1149486732 17:57048034-57048056 CTCTTGAAAGAGAAGAAGCTGGG + Intergenic
1152430194 17:80244511-80244533 CTGGTCACACAGGAGAGGCTGGG + Intronic
1153405905 18:4739193-4739215 ATCTTAACACTGTAGAAGCTTGG + Intergenic
1154385894 18:13891566-13891588 CACTTTGCACTGAAGAGGCTAGG - Intronic
1156683348 18:39617155-39617177 CTGTTAAAACTGAAGTGGCTAGG + Intergenic
1156827763 18:41452551-41452573 CTCCTAACACAGAAAAGCCATGG + Intergenic
1157064892 18:44336966-44336988 CTCTCAACAAAGAAAAGCCTGGG - Intergenic
1158110838 18:53940035-53940057 CTCTAACCACAGGGGAGGCTCGG - Intergenic
1158819410 18:61142071-61142093 CACATAACACAGAAGAGACCTGG - Intergenic
1159501027 18:69270410-69270432 CTCCCAACAAAGAAAAGGCTGGG + Intergenic
1160152752 18:76407418-76407440 CTCATAACAAAGAAGAGGGGGGG + Intronic
1160287779 18:77561511-77561533 CTCTTAAAACTGAATAGTCTAGG - Intergenic
1162030241 19:7914208-7914230 CACTTAACACTGAAGGGGGTGGG - Exonic
1164641934 19:29832611-29832633 CTCTTAAAAAAGAAAATGCTTGG - Intergenic
1164687577 19:30178027-30178049 CACATCACACAGAATAGGCTAGG - Intergenic
1165128378 19:33617083-33617105 TCCTTAACACAGAAGAGAGTTGG - Intergenic
1165502563 19:36201768-36201790 CTCTTAGCAGAGCATAGGCTAGG - Intronic
1166397558 19:42453043-42453065 CTCTTACTTCAGAAGAGACTGGG + Intergenic
1167962687 19:53119906-53119928 CTCTGAACAAAGAAAAGTCTGGG + Intronic
925097434 2:1218465-1218487 CTTTTAAAACAAAAGTGGCTTGG + Intronic
926322489 2:11759055-11759077 CCCTTTACAGAGGAGAGGCTAGG + Intronic
926833668 2:16993353-16993375 CTCCTAGCACAGAAAAGCCTGGG - Intergenic
927276403 2:21266098-21266120 CTCGTAACTCTGAAGAGGCCTGG + Intergenic
928248282 2:29651120-29651142 CTCTTAACTGAGAACAGGGTTGG - Intronic
928499066 2:31868814-31868836 GTCTTAAGACAGAAGTGGCCAGG - Intronic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
930389750 2:50745993-50746015 ATCTGAACACAGAAGAGGCTGGG - Intronic
932630979 2:73343122-73343144 CTCTTAAGGCAAAAGGGGCTGGG + Intergenic
932689246 2:73898260-73898282 CTCTTCACCGAGAAGAGGCTGGG - Intronic
935045539 2:99478746-99478768 CTGTTAAAACACAAGATGCTGGG + Intronic
935586262 2:104802522-104802544 CTCTTCTCACAGAAGACCCTGGG + Intergenic
935930307 2:108117043-108117065 CTCTGAACAAGGAACAGGCTAGG + Intergenic
935936800 2:108194457-108194479 CTAGTAAAACAGAAGAGGCAGGG + Intergenic
936702357 2:115027739-115027761 CTCTCATCAAAGAAGAGCCTAGG - Intronic
939783724 2:146482012-146482034 CTCTTAAGAGGGAAGAGCCTGGG - Intergenic
939971969 2:148672077-148672099 CTCTCAACAAAGAAAAGCCTAGG - Intronic
940676892 2:156734374-156734396 CTCTTAAAACAGAAAAACCTAGG + Intergenic
944955648 2:204805429-204805451 CTCTTAGCAAAGAAAAGCCTGGG + Intronic
945600742 2:211861371-211861393 CTTTTAGCAGAGAAGAGGTTTGG + Intronic
948284583 2:236773831-236773853 CTCTTAACGCTGACGAGGCTTGG + Intergenic
1168833225 20:858934-858956 CTCCTAAGAGAGGAGAGGCTGGG - Intergenic
1170810304 20:19669131-19669153 CTCTTAGCAGGGAAGAGGCAGGG + Intronic
1172329009 20:34061296-34061318 CTCTTAAGAGAGAAGGGGATAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175186893 20:57184816-57184838 CTCTGAAGCCAGAAGAGGCAAGG + Intronic
1175545754 20:59776659-59776681 ATTTAAACACAGAAGAGGATGGG + Intronic
1177137579 21:17322477-17322499 CTCTCAACAAAGAAAAGCCTGGG + Intergenic
1177583980 21:23065288-23065310 CTCTTTACAGAAAAGAAGCTGGG - Intergenic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1180170517 21:46055826-46055848 CGCTCAAGAGAGAAGAGGCTGGG + Intergenic
1180898606 22:19355130-19355152 TTCTTAACAGAAAAGGGGCTAGG + Intronic
1182546568 22:31080207-31080229 CTGTTAACCCAGAAGAGCCCCGG - Intronic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
1183960813 22:41410938-41410960 CTCTAAACACAAAGGAGGCCAGG - Intergenic
950464413 3:13144814-13144836 GGCTTCCCACAGAAGAGGCTGGG + Intergenic
951142550 3:19182226-19182248 ATCTTATTAAAGAAGAGGCTTGG + Intronic
953594571 3:44298166-44298188 CTTTTAAAAAAGAATAGGCTGGG + Intronic
955221416 3:57026398-57026420 CTCTTAAAATAAAAGAGGTTTGG + Intronic
955958448 3:64314350-64314372 ATCTTTTCACAGAAGAGACTTGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
957599495 3:82314952-82314974 GTCTCAACAAAGAAGAGCCTAGG - Intergenic
962064946 3:131969604-131969626 CTCTCAACACAGTGGAGACTCGG + Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964156959 3:153597874-153597896 TTCTTAACACAGCAGTGTCTTGG + Intergenic
964709519 3:159656898-159656920 CTATTACAACAGAAGAGGATGGG - Intronic
965149075 3:164946994-164947016 CTCTCAAGAAAGAAAAGGCTGGG + Intergenic
965961193 3:174430498-174430520 CTCTTAACACAGAACACAATTGG - Intergenic
966224388 3:177582312-177582334 CTCTTTGCACAGAGGAGGCAGGG + Intergenic
967159730 3:186725004-186725026 CCCTAAACAAAGAAGAGGCTGGG - Intronic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
969922773 4:10556702-10556724 CTCTTAACAGAGAAAGGGTTGGG - Intronic
971498776 4:27296347-27296369 CTTTTAACACAGAAGAGATTGGG - Intergenic
972953719 4:44362744-44362766 CCTTTAACACAGAAGAAACTAGG - Intronic
973973558 4:56239797-56239819 GTGTTAACACATAAGAGTCTGGG - Intronic
974908374 4:68084475-68084497 CTTATAAGCCAGAAGAGGCTGGG + Intronic
975182090 4:71358004-71358026 CTCTTAACACTAAAAAGCCTGGG - Intronic
975223765 4:71845272-71845294 CTCTCAACACAGAAAAGCCTAGG - Intergenic
975333157 4:73142765-73142787 CTCCTAAAACAGAAAAGGCATGG + Exonic
976021049 4:80626855-80626877 CTCCTATCAAAGAAGAGTCTGGG + Intronic
976494527 4:85712224-85712246 CTGTTAAGAGAGAAGAGGGTGGG + Intronic
978282483 4:107035326-107035348 TTCTTCAGACAGAAGAGGCAGGG - Intronic
980910261 4:138987855-138987877 CACTAAAAACAGAAAAGGCTGGG - Intergenic
980968697 4:139548818-139548840 CTCTTAACACAAAAGAGGAAAGG + Intronic
981594787 4:146407696-146407718 CTGTTAACATATAAGAGGGTGGG - Intronic
982639124 4:157934649-157934671 ATCTAATAACAGAAGAGGCTGGG - Intergenic
983755676 4:171331734-171331756 TTCTCAACCCAGAAGAGACTGGG + Intergenic
984168883 4:176337287-176337309 TTCATAACACTGAAGAAGCTGGG - Intergenic
986148790 5:5107530-5107552 TTATTATCACAGAAGAGGGTGGG + Intergenic
987152112 5:15053169-15053191 CTCTCAACAAAGAAAAGCCTAGG - Intergenic
987763287 5:22192713-22192735 CTCTTATCCCAGAATAGACTGGG + Intronic
993951631 5:94182969-94182991 CTCTTGGGACAGAACAGGCTAGG - Intronic
996797020 5:127358548-127358570 TTCTAAAAACAGAAGAGCCTGGG + Intronic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
998097024 5:139401808-139401830 CTCTTGACACTGGAGAGCCTGGG + Exonic
998420886 5:141985501-141985523 CTCTTAATACAGAAAAGCTTTGG + Intronic
1000130692 5:158295177-158295199 CTCTTTTCATAGAAGATGCTCGG - Intergenic
1001314856 5:170634650-170634672 CTCTTACCATTGAAGAGCCTGGG - Intronic
1002212604 5:177607749-177607771 CCCTTAACACTGAAGAGTGTAGG + Intronic
1003502286 6:6712536-6712558 CTCTGCACACAGCAGAGGCTTGG + Intergenic
1004434120 6:15573998-15574020 CTTTTAACAAAGGAGAGTCTGGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006215238 6:32436447-32436469 CTATTAACACAGGACATGCTAGG + Intergenic
1006353714 6:33540997-33541019 CTCTTAAAAAAGAATAGGCTGGG + Intergenic
1006533918 6:34682165-34682187 GTCTTAAAACAGACAAGGCTGGG - Intronic
1010180478 6:73081149-73081171 GTTTGAACACAGAAGAGGCTTGG + Intronic
1012995171 6:105965632-105965654 CTCTTAAAAGAGAGAAGGCTGGG + Intergenic
1014748364 6:125226772-125226794 CTTTTACCACAGAAAATGCTTGG - Intronic
1015789306 6:136950534-136950556 ATCTCCACACAGAACAGGCTGGG + Intergenic
1016079103 6:139833980-139834002 ATCTTATTACAAAAGAGGCTGGG - Intergenic
1016356451 6:143224015-143224037 CACGTAACACAGAAGAGGCAGGG - Intronic
1017971294 6:159314795-159314817 CTCTGAACACAGGATAAGCTGGG + Intergenic
1019593594 7:1848013-1848035 CTCATGACAGAGAAGCGGCTGGG + Exonic
1022141453 7:27496532-27496554 CTCTTACCAGAGAAGAGATTGGG + Intergenic
1022275199 7:28847949-28847971 TTCCTAACACAGATGAGGCCGGG - Intergenic
1022560570 7:31345021-31345043 CTCTTAACACAGACGATTCCTGG + Intergenic
1023025191 7:36043387-36043409 CTCTAAAAACAAAACAGGCTGGG + Intergenic
1023655550 7:42416051-42416073 CTGTTAAAACAAAACAGGCTGGG - Intergenic
1026882123 7:73913905-73913927 TTCTCAACAAAGAAGAGCCTAGG - Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029271461 7:99379609-99379631 ATCTTAATCCAGATGAGGCTGGG - Intronic
1030358155 7:108566234-108566256 CTCTTATCAGATAAGAGCCTTGG - Intronic
1030549173 7:110936768-110936790 CTGTTAAAACAGCAAAGGCTTGG + Intronic
1030690818 7:112531036-112531058 CTCTGAACATAGGAGAGGATAGG - Intergenic
1031729670 7:125283292-125283314 TTCTTAAAACAGTAGAGGGTGGG - Intergenic
1031767117 7:125794630-125794652 GTGTTAACACAGAAGAGGCCAGG + Intergenic
1032256102 7:130298150-130298172 GTCTTAAAACAGGCGAGGCTGGG - Intronic
1034657566 7:152741612-152741634 CCCTTCACACAGAGGAGGTTGGG + Intergenic
1036248503 8:7141424-7141446 CTATTTAAAAAGAAGAGGCTGGG + Intergenic
1038159309 8:25021679-25021701 CTCTTCACGCAGTAGAGGCAAGG + Intergenic
1039195689 8:35028970-35028992 TTCATAACACAGAAGATGCTGGG + Intergenic
1040337237 8:46422286-46422308 CTCTTATCACAGAAGCTTCTAGG + Intergenic
1040753659 8:50743013-50743035 CTGTCAACAGAGAAGAGGCCTGG + Intronic
1042317491 8:67439290-67439312 TTCTTAAAAGAAAAGAGGCTGGG + Intronic
1042326113 8:67529602-67529624 CACAGGACACAGAAGAGGCTGGG + Intronic
1044515077 8:93128178-93128200 GTCCTAACACAGAAGAGGGAAGG + Intergenic
1045061199 8:98412737-98412759 TTTTTAACATAGAAGAAGCTCGG + Intronic
1045110021 8:98931529-98931551 CACTGACCACAGCAGAGGCTTGG - Intronic
1045648887 8:104324886-104324908 CTCTGTACACAGAACAGACTTGG + Intergenic
1049572810 8:143377624-143377646 CCCTGAACGCAGCAGAGGCTGGG - Intronic
1051577768 9:18636747-18636769 CTATAAACAAAGAAGAGGATGGG + Intronic
1051650899 9:19323137-19323159 CTCTTAAAAGAAAAGAGGCTAGG + Intronic
1052930232 9:34049660-34049682 CTTTTCACCCAGAAGGGGCTTGG - Intergenic
1056177554 9:84050130-84050152 TACTTAACAAAGAAGAGGGTTGG + Intergenic
1056583822 9:87915087-87915109 CACCCCACACAGAAGAGGCTGGG - Intergenic
1056584314 9:87918556-87918578 CACCCCACACAGAAGAGGCTGGG - Intergenic
1056612555 9:88134366-88134388 CACCCCACACAGAAGAGGCTGGG + Intergenic
1056613047 9:88137834-88137856 CACCCCACACAGAAGAGGCTGGG + Intergenic
1057532414 9:95862843-95862865 CTCCTAACAAAGAAAAGCCTCGG - Intergenic
1061948243 9:133920663-133920685 CCCGTCACACAGAGGAGGCTTGG + Intronic
1187292538 X:17969131-17969153 CATTTAAGACAGGAGAGGCTGGG + Intergenic
1189455893 X:41189412-41189434 CTCTTAGTAAAGAAAAGGCTTGG + Exonic
1189582014 X:42416038-42416060 CTCTCAACAGAGACAAGGCTAGG + Intergenic
1190487653 X:50943792-50943814 ATATTTAAACAGAAGAGGCTGGG - Intergenic
1191891394 X:65946158-65946180 CACCTAACATAGAAGAAGCTAGG - Intergenic
1196200709 X:112882820-112882842 CTCCAGACACAGAAGAGACTTGG - Intergenic
1197995809 X:132371231-132371253 CTCTTAACAGTGAAGAGGGTCGG - Intronic
1198660197 X:138960350-138960372 CTCTCAAGACAGAAGAGAGTGGG - Intronic
1198692632 X:139301020-139301042 CCCTTACCACAGAGGAGGATGGG - Intergenic
1199975459 X:152892623-152892645 CTCTTCACACAGGAGAGGAAAGG - Intergenic
1200132250 X:153856984-153857006 CTCTTCAAACAGAGGAGGCTGGG - Intergenic
1201598502 Y:15699819-15699841 ATCATATCACAGAAGAGGATGGG - Intergenic