ID: 997612085

View in Genome Browser
Species Human (GRCh38)
Location 5:135222401-135222423
Sequence CAAGCTCCTCCCATGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997612085_997612090 -6 Left 997612085 5:135222401-135222423 CCACCCTACATGGGAGGAGCTTG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 997612090 5:135222418-135222440 AGCTTGGGTTCAGCATAAGTAGG 0: 1
1: 0
2: 1
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997612085 Original CRISPR CAAGCTCCTCCCATGTAGGG TGG (reversed) Intronic
900593473 1:3469937-3469959 CAAGCTGCTCACCTGTAGGCAGG + Intronic
900808292 1:4782122-4782144 CAGTTTCCTCCCATGGAGGGTGG - Intronic
902289082 1:15425099-15425121 CAAGGTTCTGCCATCTAGGGTGG + Intronic
904037242 1:27565374-27565396 CAAGCTCATTCCATGAAGAGGGG + Intronic
904401233 1:30257998-30258020 CAACCTCCTCCCCTGTGGAGTGG - Intergenic
904455111 1:30642845-30642867 CAACTTCCTCCCATGTGGAGCGG + Intergenic
904886626 1:33743196-33743218 GAAGGTGCTCCCATGGAGGGAGG - Intronic
905288993 1:36908467-36908489 CAAGCTCCACCCATGCAAGAAGG + Intronic
905640854 1:39588854-39588876 CCTCCTCCTCCCAAGTAGGGGGG + Intergenic
906901558 1:49842149-49842171 CATGCTCCTCCAATGCAGTGTGG - Intronic
907417168 1:54322628-54322650 CAAGATCCTCCCCTGCAGGAAGG + Intronic
907420252 1:54342371-54342393 CCATCTCCTCCCAGGGAGGGAGG - Intronic
907916808 1:58877831-58877853 CAAGCTGCTCCCATATAAGGTGG + Intergenic
913543179 1:119841377-119841399 CAAGCTCAGCCCAGGTAAGGTGG - Intergenic
919495475 1:198261149-198261171 GAAATTCCTTCCATGTAGGGTGG - Intronic
1062797361 10:354598-354620 CACGCTGCTCCCATGTGTGGGGG - Intronic
1067311049 10:45113940-45113962 CAAGCTCCTCCCAGGCGTGGTGG - Intergenic
1067843426 10:49700066-49700088 CAGGTTCCTCCCATGTGAGGAGG - Intronic
1073457584 10:103646989-103647011 CAACCACCTCCCTTGGAGGGAGG + Intronic
1076163080 10:128261006-128261028 CATGATCCTCCCTTGCAGGGAGG - Intergenic
1077042198 11:529797-529819 CCAGCTCCTCCCCTTGAGGGAGG - Intergenic
1078183120 11:9029043-9029065 CAAGCTCCTCCAGTTTAGGGGGG + Intronic
1084312022 11:68322589-68322611 CAAGGCCCTCCCAGGTTGGGTGG - Intronic
1084770804 11:71341803-71341825 CCAGCTCCTCCCACCTATGGGGG - Intergenic
1089586024 11:119510186-119510208 CAAACTCCTCCCTTCTAGAGAGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091097668 11:132839419-132839441 CAAGCGCCTCCCATATGGGAAGG - Intronic
1091174100 11:133544449-133544471 CAACCACCTCCCATGGAAGGAGG + Intergenic
1091408405 12:223230-223252 TAATCTCCTCCCATGCAGGGCGG - Exonic
1095951210 12:47783002-47783024 CAGGCTACTCCTATGTGGGGTGG + Exonic
1100019331 12:90050446-90050468 CAAGCTCCTTTCATGCATGGTGG - Intergenic
1100143156 12:91643487-91643509 CAAGCTCTTCACATGTTGGGTGG + Intergenic
1101277097 12:103214802-103214824 CAAGCTTGGCCCATGGAGGGAGG + Intergenic
1102055922 12:109896432-109896454 CAAACTCCTCCCAGGTTGGAGGG + Intergenic
1102931995 12:116869431-116869453 CAAGCCACTCACATGTAGAGGGG + Intronic
1104738376 12:131154046-131154068 CAGGCTCTTTCCATGTGGGGTGG + Intergenic
1104794389 12:131507057-131507079 CAGGCTCTTTCCATGTGGGGTGG - Intergenic
1105759147 13:23497503-23497525 CAATCTCATCCCATCTTGGGTGG + Intergenic
1106308733 13:28534866-28534888 CATGCTCCTTCCAAGTTGGGAGG + Intergenic
1108574365 13:51778712-51778734 TGAGCACCTCCCAGGTAGGGAGG - Intronic
1117720397 14:58623611-58623633 CATGCACCTCCCAAGTAGGTGGG - Intergenic
1119348503 14:73945219-73945241 CAATTTCCTCCTATGTAGAGTGG + Intronic
1120119639 14:80663717-80663739 CAGCTTCCTCCCTTGTAGGGGGG - Intronic
1122860909 14:104582016-104582038 GAAGGACCTCCCATGTGGGGTGG + Intronic
1124835679 15:33194379-33194401 CAAGCTGCTCCCAAGTACGTTGG - Intronic
1127468141 15:59265181-59265203 TAAGCTCCTTCCATGGAGGAGGG + Intronic
1128748719 15:70133292-70133314 AAAGCTGCTCACATGGAGGGAGG + Intergenic
1128986680 15:72227114-72227136 CAAGCTCCCCGCAAGTATGGTGG + Intronic
1130100288 15:80888254-80888276 CAATCTCCTCCCAAGTAGCTGGG - Intronic
1131707451 15:95013512-95013534 GAAGCTCCTACCATTTAGGGAGG - Intergenic
1134007504 16:10828013-10828035 CAGGCCCCTCCCATGGAGGCAGG + Intergenic
1146039922 17:29442159-29442181 CAACCTCCTCCCAAGTAGCTGGG + Intronic
1146707434 17:35011591-35011613 CAAGCATCTCCCATATGGGGTGG + Exonic
1147138431 17:38448162-38448184 CCAGTTCCTCCCAAGCAGGGAGG - Intronic
1148127728 17:45245533-45245555 TGAGCTCCTCCCAGGCAGGGTGG - Intronic
1149803694 17:59594482-59594504 CAAGCTTCTGCTATTTAGGGAGG - Intronic
1149842797 17:59981002-59981024 CAAGCTTCTGCTATTTAGGGAGG + Intergenic
1151357000 17:73565074-73565096 CTAGCTCCTGCCAAGTGGGGTGG + Intronic
1151683771 17:75635227-75635249 CAAGCTCCTGCGGTGTTGGGAGG + Intronic
1153953558 18:10076834-10076856 GATCCTCCACCCATGTAGGGCGG + Intergenic
1158122005 18:54058848-54058870 CAAGGTCCTGCCTTGTAAGGAGG - Intergenic
1158200925 18:54939654-54939676 GAAGCTCCTCCTATCTATGGTGG + Intronic
1158456768 18:57615063-57615085 AACGATCCTCCCAAGTAGGGGGG - Intronic
1158855839 18:61542756-61542778 CAAGCTGCTTCCATGCATGGAGG + Intronic
1160271040 18:77383581-77383603 GAAGCTCCTCCCAGGTGGGCTGG + Intergenic
1160419660 18:78735335-78735357 CAAGGTCCTCCCATGGAGAGGGG + Intergenic
1160747185 19:717593-717615 CAAGCTCCAACCATCTCGGGGGG - Intronic
1164534478 19:29075164-29075186 CAAGTTCCAGCCTTGTAGGGTGG - Intergenic
926120554 2:10239258-10239280 CCAGCTCCCCCCATGATGGGTGG - Intergenic
927081286 2:19633352-19633374 CAAGCTCCCCCCATGGACGCAGG + Intergenic
928096227 2:28406818-28406840 CAGGCTCCTCCCTAGCAGGGAGG - Intronic
928200228 2:29243195-29243217 CAAGGTCCTCCCTGGGAGGGAGG - Intronic
929874741 2:45787124-45787146 CACGCTCCTCCCAGCTTGGGGGG - Intronic
931937765 2:67217103-67217125 CATGCTTCTCCCATTGAGGGAGG - Intergenic
932403012 2:71495151-71495173 CAAGCTCCAACAATGCAGGGTGG + Intronic
934947521 2:98552592-98552614 CAAGCTCCTGCCATATAGACAGG + Intronic
936121670 2:109751490-109751512 CAATCTCCTCCCATTGAGGGGGG - Intergenic
936223027 2:110619984-110620006 CAATCTCCTCCCATTGAGGGGGG + Intergenic
936246419 2:110832079-110832101 CAAACTCCTCCCAAGTAGCTGGG - Intronic
936284226 2:111168891-111168913 CCAGCTCCCGTCATGTAGGGTGG + Intergenic
937282006 2:120724317-120724339 CAAGCTGCTTCCATTTATGGTGG + Intergenic
937323594 2:120975527-120975549 GAAGCTTCTCCCATGAAGGAAGG + Intronic
938067911 2:128291980-128292002 CAAGCTCCTCCATCCTAGGGTGG + Intronic
941714475 2:168749372-168749394 CAAGCCCATCCCATATAGGCAGG + Intronic
948182435 2:235992914-235992936 CCAGGTTCTCCCAGGTAGGGAGG - Intronic
1172503888 20:35446810-35446832 CCAGCTCCTAACCTGTAGGGTGG - Intronic
1173823922 20:46035391-46035413 CCATCTCCTCCTATGGAGGGAGG - Exonic
1175145536 20:56893350-56893372 CAGGCTCCTCCCCTGTGGGCGGG - Intergenic
1175162680 20:57020740-57020762 CCAGCTCCTCCCCTGCAGGCAGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1179124223 21:38577337-38577359 CAAGCTCCGCCAATCTTGGGAGG - Intronic
1179960477 21:44764725-44764747 AGAGCTCCTCCAATGTGGGGTGG - Intergenic
1181058075 22:20269116-20269138 CATGGTCCTCTCATGCAGGGTGG - Intronic
1181514620 22:23403565-23403587 CATGGTCCTCTCATGCAGGGTGG - Intergenic
1183742843 22:39678203-39678225 CATGCCCCTCCCATGTGTGGTGG - Intronic
1185306843 22:50123093-50123115 CAAGCGCCTCCCAGGTAGCTGGG - Intronic
949927517 3:9053560-9053582 CAAGTTCCTCCAATGCAAGGTGG + Intronic
950397047 3:12741552-12741574 CAAGCACCTCCAATGTCTGGGGG + Intronic
959684411 3:109129172-109129194 CAAGCCCCTCCCATGACAGGTGG + Intergenic
961372023 3:126437095-126437117 CAAAAGCCTCCCATGGAGGGAGG + Intergenic
968973683 4:3810247-3810269 CCAGCTCCCCCTGTGTAGGGAGG + Intergenic
969260782 4:6032001-6032023 CAACCCCCTCACATGCAGGGCGG + Intronic
970151597 4:13095944-13095966 GAGGCTCCTCCCCAGTAGGGTGG + Intergenic
972333696 4:38086603-38086625 CAAGCTCCTGCCATGTGTTGAGG + Intronic
974173791 4:58299399-58299421 CAAGTTCTTCCCATCTAGTGGGG + Intergenic
986996343 5:13611622-13611644 CAAGTTCATCACATGTAGGGAGG - Intergenic
987296818 5:16560608-16560630 CTAGCTCCTGCCATGTGAGGGGG + Intronic
991158815 5:63470436-63470458 CATGATCCTCCCAAGTAGGTGGG - Intergenic
992320825 5:75611741-75611763 CAGGCTCCTCCAAGGCAGGGCGG - Exonic
993191379 5:84686680-84686702 CCTGCTCCTCCCAAGTAGGTGGG + Intergenic
997356908 5:133268426-133268448 CAAACAACACCCATGTAGGGGGG - Intronic
997612085 5:135222401-135222423 CAAGCTCCTCCCATGTAGGGTGG - Intronic
998963452 5:147511988-147512010 CAGCCTCCTCCCAAGTAGGTGGG - Intergenic
1003131377 6:3397970-3397992 CAAACACTTCCCATGTAGTGAGG + Intronic
1004764377 6:18709109-18709131 AAATCTCCCTCCATGTAGGGAGG + Intergenic
1013876292 6:114833828-114833850 CAAGCTCCTACCAAGTGGGCTGG + Intergenic
1014699764 6:124670010-124670032 CTATCTCCTCCCATGTAGGTTGG + Intronic
1015842425 6:137489285-137489307 CAAGCTCTTCACGTGTAGGCAGG - Intergenic
1016652559 6:146479524-146479546 CAAGTTCCTCCCATGAAATGTGG - Intergenic
1022138245 7:27469046-27469068 CAAGCACGTCCCATGTCGAGAGG + Intergenic
1022350563 7:29563763-29563785 CAATCTCCTCCCCTGGAGGGTGG + Intergenic
1027688138 7:81303935-81303957 CAACCTCCTTCCATGCAGGCTGG + Intergenic
1034900979 7:154907660-154907682 TGAGCTCCCCCCATGGAGGGAGG + Intergenic
1036126537 8:6068267-6068289 CAAGATGATGCCATGTAGGGTGG - Intergenic
1041152139 8:54945422-54945444 CAAGCGACTCCCCTGAAGGGTGG + Intergenic
1045385272 8:101666573-101666595 CAAGATGCTGCCATGGAGGGGGG - Exonic
1048317764 8:133374910-133374932 CAGGCACCTGCCATGTAAGGGGG + Intergenic
1051544029 9:18254140-18254162 CAATTTCCTCCCCTGTAGGATGG + Intergenic
1053073756 9:35116002-35116024 CGAGCTCCTCCCCTGTAGCCCGG + Intronic
1053141902 9:35687849-35687871 CAAGCTCTTCCCAGTTACGGGGG + Intronic
1054922101 9:70553238-70553260 CAAGCTCCTGTCTTGCAGGGAGG + Exonic
1056048447 9:82743485-82743507 CAAGCTGCTTTCATTTAGGGTGG - Intergenic
1061497190 9:130981767-130981789 CACCCTCCTTCCATGGAGGGGGG - Intergenic
1061754742 9:132804549-132804571 CAGGCTCTTCCCAGGGAGGGGGG + Intronic
1185755344 X:2648913-2648935 AAAGCACCTGCCATGTAGAGAGG - Intergenic
1189578878 X:42384602-42384624 CAAGGTTCTCCCAGGCAGGGAGG + Intergenic
1196050657 X:111300047-111300069 CAAGCTCATTCCATTTAGAGTGG + Exonic
1198063885 X:133076503-133076525 CAATCTCCTCCCCTTGAGGGTGG + Intronic
1200048692 X:153416836-153416858 CAAGCTGCTTCCATTCAGGGTGG + Intergenic