ID: 997612586

View in Genome Browser
Species Human (GRCh38)
Location 5:135225651-135225673
Sequence CCAGGGGTTCGGCGTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997612586_997612594 6 Left 997612586 5:135225651-135225673 CCCACAGAACGCCGAACCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 997612594 5:135225680-135225702 GGAGCCACCTCTGCTCTGTGTGG No data
997612586_997612596 12 Left 997612586 5:135225651-135225673 CCCACAGAACGCCGAACCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 997612596 5:135225686-135225708 ACCTCTGCTCTGTGTGGCAAAGG 0: 1
1: 0
2: 1
3: 21
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997612586 Original CRISPR CCAGGGGTTCGGCGTTCTGT GGG (reversed) Intronic