ID: 997612923

View in Genome Browser
Species Human (GRCh38)
Location 5:135227732-135227754
Sequence ACCACTCATGCCCTTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997612923 Original CRISPR ACCACTCATGCCCTTACCCA TGG (reversed) Intronic
900954372 1:5877635-5877657 CCCACTAATGCCTTCACCCAGGG + Intronic
901909888 1:12448080-12448102 ACCACCCATGGAGTTACCCACGG - Intronic
903017755 1:20372585-20372607 ACGACTTAAGCCCTTGCCCAAGG + Intergenic
903806020 1:26006124-26006146 ACCACTCCTGCCCCCACCCTGGG - Intergenic
905347192 1:37319167-37319189 CTCACTCAGGCCCTCACCCAGGG - Intergenic
905347261 1:37319470-37319492 CACACCCAGGCCCTTACCCAGGG - Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
911019699 1:93374420-93374442 ACCACCCCTCCCCTAACCCAAGG - Intergenic
912459709 1:109822489-109822511 ACTCCTCATTGCCTTACCCAAGG - Intergenic
1063018760 10:2104957-2104979 ACCTCTCAGGCTCTCACCCAAGG - Intergenic
1064566122 10:16640855-16640877 ACCACTGAATCCCTTAGCCAAGG + Intronic
1066352525 10:34649597-34649619 ACCACTCACTCACTCACCCAGGG - Intronic
1067164266 10:43852756-43852778 AGCACTCATGCCCAGACCCCTGG - Intergenic
1070074322 10:73120370-73120392 ACCACTAATGCCTTAAACCAGGG + Intronic
1070816556 10:79328204-79328226 CCCACTCCTGCCTTTCCCCAGGG - Intergenic
1074238952 10:111617243-111617265 ACCACACTTGACCTGACCCAGGG + Intergenic
1077131791 11:976636-976658 GCCACACATGCCCTTGCCCCTGG - Intronic
1078045268 11:7908356-7908378 ACCTCTCACACCCATACCCAGGG + Intergenic
1078860631 11:15243261-15243283 ACCATTCCTGCTCTTCCCCAAGG + Intronic
1080042179 11:27770506-27770528 ACCACTCATGCATTTGCTCAAGG - Intergenic
1089399404 11:118155817-118155839 ACCACCCCTGCCCTCCCCCAAGG - Intergenic
1089588000 11:119522184-119522206 ACCACTCATCCCTTTGCCCCAGG - Intergenic
1091400234 12:176868-176890 ACCTCTGATGCCCTTAGCCAGGG + Exonic
1093514775 12:19973004-19973026 AATACTCAGGCCCTTTCCCAGGG - Intergenic
1097347863 12:58514681-58514703 ACAACACATGCCATTTCCCAAGG - Intergenic
1098161962 12:67654386-67654408 ACCACTCTTGCTTTTGCCCAAGG - Intronic
1102366063 12:112335760-112335782 ACCACTAATGAACTTACTCATGG + Intronic
1103906958 12:124332759-124332781 TCCGATCATGCCCTTCCCCAGGG + Intronic
1107456031 13:40555353-40555375 AGCACTTATGACCTTAGCCATGG + Intergenic
1107568673 13:41632973-41632995 ACCACAAATGCCCTTAGCTACGG - Intronic
1109703450 13:66057282-66057304 ACCCCTCATGCACTTACCCTAGG + Intergenic
1113967704 13:114163781-114163803 ACCACTCCTGCCCCTGCCCTCGG - Intergenic
1116963253 14:50988768-50988790 TCCCTTCATGCCCTTCCCCATGG + Intronic
1118192644 14:63594475-63594497 ACCACCCAGGGCCTTCCCCAGGG + Intergenic
1123131167 14:105986736-105986758 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123135615 14:106025299-106025321 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123151362 14:106185053-106185075 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123176655 14:106425513-106425535 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123185320 14:106511269-106511291 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123206082 14:106714836-106714858 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123208547 14:106737264-106737286 TCCACTCAAGCCCTTTTCCAGGG + Intergenic
1123211166 14:106762246-106762268 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123223083 14:106874735-106874757 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1123481832 15:20639617-20639639 TCCACTCAAGCCCTTTTCCAGGG + Intergenic
1123636181 15:22360748-22360770 TCCACTCAAGCCCTTTTCCAGGG - Intergenic
1124690498 15:31817733-31817755 ACCACCCATGCCCTTGGCCTGGG + Intronic
1127259482 15:57317764-57317786 ACCACTCATTTCATTACCCAGGG + Intergenic
1131007241 15:88987983-88988005 ACCACCCATTCCCTTGCCCAGGG + Intergenic
1131568787 15:93510838-93510860 ACAACTCATTCCCTCACCAATGG + Intergenic
1131648809 15:94376250-94376272 AAGGCTCATGCACTTACCCAAGG - Intronic
1131845776 15:96489228-96489250 AAAGCCCATGCCCTTACCCAGGG - Intergenic
1135641321 16:24122229-24122251 ACCAAACATGCTCTTACCCCAGG - Intronic
1136693991 16:32059344-32059366 TCCACTCAAGCCCTTGTCCAGGG - Intergenic
1136794485 16:33002593-33002615 TCCACTCAAGCCCTTGTCCAGGG - Intergenic
1136875425 16:33851790-33851812 TCCACTCAAGCCCTTGTCCAGGG + Intergenic
1139691357 16:68643976-68643998 ACCCCACAAGCCCTTCCCCACGG - Intronic
1140600015 16:76464285-76464307 TCCAGTCATGCTCTTGCCCATGG - Intronic
1141201717 16:81903399-81903421 TGCACTGATGCTCTTACCCATGG - Intronic
1142351881 16:89584338-89584360 ACCACTCATGACCCTGCTCAGGG + Intronic
1142424000 16:89991087-89991109 CCCACACATGCCCATGCCCAGGG - Intergenic
1203096748 16_KI270728v1_random:1264260-1264282 TCCACTCAAGCCCTTGTCCAGGG - Intergenic
1147642323 17:42010892-42010914 ACCACTCATATTCTTACCCATGG + Intronic
1149353577 17:55816540-55816562 ACCTCATATGCCATTACCCATGG + Intronic
1150446405 17:65230105-65230127 TACACCCATGCCCATACCCAGGG + Intergenic
1152356136 17:79808515-79808537 ACCACTGATGCACATGCCCAGGG + Intergenic
1155138425 18:23019726-23019748 ACCACTAATGCCCTGGACCAAGG + Intronic
1156687047 18:39662841-39662863 ACCACTCAGGCCTTCACTCAGGG - Intergenic
1158126253 18:54102619-54102641 CCCTCTCATGCCCTACCCCAGGG - Intergenic
1161354895 19:3813532-3813554 ACCTCCCTTGCCCTTACCCAGGG - Intronic
1165097339 19:33416812-33416834 ACCACTCATGCAGTTCCCCCAGG - Intronic
1165395942 19:35563609-35563631 CCCACTCACGGCCTTCCCCATGG + Exonic
1167070992 19:47221834-47221856 GGGACTCCTGCCCTTACCCAGGG - Exonic
1168274004 19:55266098-55266120 CCCACTCCTGCCCTCACTCAAGG + Intronic
925699271 2:6617245-6617267 TCCACTCCTTCCCTTTCCCATGG - Intergenic
925765723 2:7233395-7233417 ACCACTAATGCTCTAGCCCAAGG - Intergenic
927960078 2:27235664-27235686 CCCACTGCTGCCCTTCCCCAAGG + Intronic
928220576 2:29399724-29399746 CCCTCTCATGCCCCTACCAAAGG - Intronic
929240606 2:39649628-39649650 AGCCCTCACTCCCTTACCCAAGG - Intergenic
929944150 2:46357756-46357778 AGCATTCAGGACCTTACCCATGG + Intronic
930223811 2:48771586-48771608 ACTACTCATGCCCCTATCCATGG - Intronic
930758501 2:55004833-55004855 ACCCCTCATGCCCTTCCCTTAGG + Intronic
934512042 2:94953311-94953333 TCCACTCAAGCCCTTTTCCAGGG + Intergenic
934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG + Intergenic
938410174 2:131057078-131057100 ACCCCTCCTGCTCTCACCCATGG - Intronic
939013633 2:136876266-136876288 ACCACTCATTTGCTTTCCCAGGG + Intronic
947404502 2:229760808-229760830 ACCACTCCTGCCCACTCCCATGG + Intergenic
948807369 2:240458872-240458894 ACCACTTCTGCCTTCACCCAGGG + Intronic
1169216823 20:3799032-3799054 ACCACCCATGCCCACAGCCAAGG - Intronic
1172112156 20:32553316-32553338 ACCACTCACCCCCACACCCAGGG + Intronic
1175138885 20:56844973-56844995 ACCTCTCCTGCCCTCACCAAAGG - Intergenic
1175257234 20:57654880-57654902 TCCACTCTTGCCCTTCCCCAGGG + Intronic
1175594832 20:60222682-60222704 CCTACTCATGCCCTGCCCCAGGG - Intergenic
1177222293 21:18209986-18210008 ACCACTTATACCCCAACCCAAGG - Intronic
1178664199 21:34532370-34532392 CCCACTCATACCCTTGTCCAAGG + Intronic
1180131585 21:45830241-45830263 ACCACTCCTGCCCCTACCCTGGG + Intronic
1184206805 22:43009758-43009780 ACCACACATGCACTTTCCAAAGG + Intronic
1184752439 22:46495433-46495455 ACCACTCACCCACTTACCCAGGG - Intronic
950534079 3:13569392-13569414 ACCACTCCTCCCCTTTCCCAGGG - Intronic
951085820 3:18511437-18511459 ACCACATATGCCATGACCCAAGG + Intergenic
952201272 3:31130651-31130673 ACCACACATGCCTTTCCCAAGGG + Intergenic
952672967 3:35993526-35993548 ACCACTCCTCCCATTACCCAAGG + Intergenic
954123965 3:48517886-48517908 CCCACTCATGCCCTGATCCCTGG + Exonic
954972675 3:54664259-54664281 GCCACTACTGGCCTTACCCATGG - Intronic
955459048 3:59160002-59160024 AACACTCATACCCTGACTCAAGG - Intergenic
956285354 3:67603074-67603096 ACCACATATGCCATTACCCTAGG + Intronic
956559017 3:70552671-70552693 ACCAATCATGCCTTTCACCATGG - Intergenic
957525243 3:81371688-81371710 ACCACCCATCCACTTACCAAGGG + Intergenic
959883733 3:111474984-111475006 ACCACTAAAGGCCTTACTCAAGG - Intronic
960515983 3:118603267-118603289 ACCACTTCTGCCCTTGCCTATGG - Intergenic
960541410 3:118865977-118865999 ATCACTCCTCCCCTTACCCTAGG - Intergenic
970168036 4:13260761-13260783 ACAACTCATGAGCTTACACATGG + Intergenic
978210476 4:106130015-106130037 ACCACTTATTCCCTTAACTAGGG + Intronic
979337519 4:119480305-119480327 ACCACTCATTCCCAGAACCAAGG - Intergenic
981582703 4:146266400-146266422 ACCACACATGCCCATGCACATGG + Intronic
985169667 4:187135580-187135602 ATCTCTCATGCCCTTAGCCTGGG - Intergenic
991141884 5:63254068-63254090 ACCACACATGCACTTGCCTAAGG + Intergenic
992354058 5:75962288-75962310 ACAACACATGTCCTTACCCTGGG - Intergenic
997612923 5:135227732-135227754 ACCACTCATGCCCTTACCCATGG - Intronic
998122863 5:139593366-139593388 AACACTCAAGTCCTTACCCTTGG + Intronic
1001246774 5:170110917-170110939 ACCCCTCAGGCCCTTTCCCTGGG + Intergenic
1001256850 5:170190136-170190158 ACCACTAAAGAACTTACCCACGG + Intergenic
1002687004 5:181020654-181020676 ACCACTCTGGCCCTTTCTCACGG + Intergenic
1005675682 6:28152379-28152401 ACCACACCTCTCCTTACCCAGGG - Exonic
1005714915 6:28537814-28537836 ATCACCCATGACCTTAACCAGGG - Intergenic
1006063896 6:31447025-31447047 ACCACTCACTCACTCACCCAGGG - Intergenic
1010940580 6:81912103-81912125 GCCACAGATGCCCTTGCCCATGG + Intergenic
1012351971 6:98262974-98262996 GCCACTCATGCTTTTGCCCATGG - Intergenic
1013296550 6:108762773-108762795 ACCACTCCTTCCCTTTCCAAGGG + Intergenic
1013886762 6:114976610-114976632 TCCATTCTTGCCATTACCCATGG - Intergenic
1014728603 6:125004353-125004375 ATTACTTATGCCCTTACCCTTGG + Intronic
1017065209 6:150522527-150522549 ACTGCTCATGTCCTTAACCATGG - Intergenic
1018983977 6:168621876-168621898 ACCACTCATTGCGTTACACAGGG + Intronic
1020414230 7:7927769-7927791 AACCCTCATGCCCTTTCACATGG - Intronic
1021161830 7:17283124-17283146 AACACTTATGCCCTTACCATAGG + Intergenic
1022044562 7:26612635-26612657 ACCACACTGGCCCTCACCCAGGG + Intergenic
1023943395 7:44784714-44784736 CTCACTCATGCCCCTCCCCAGGG + Intergenic
1025082944 7:56000342-56000364 ACCAGGCATGACCTTGCCCAGGG - Intergenic
1025840003 7:65137292-65137314 AAAGCCCATGCCCTTACCCAGGG - Intergenic
1025883061 7:65558672-65558694 AAAGCCCATGCCCTTACCCAGGG + Intergenic
1025890383 7:65643933-65643955 AAAGCCCATGCCCTTACCCAGGG - Intergenic
1026480399 7:70773862-70773884 ACCACACATGCTCTTTCTCAAGG - Intronic
1030937538 7:115603830-115603852 ACCACTGCTGCCCCTATCCATGG + Intergenic
1031852101 7:126878072-126878094 AAAGCCCATGCCCTTACCCAGGG + Intronic
1036429313 8:8675095-8675117 ACCATTCAAGCACTTCCCCATGG - Intergenic
1038416504 8:27400177-27400199 ACCACACATTCCCTTCCCGAGGG - Intronic
1039816652 8:41100512-41100534 ATCACACCTGCCCTTTCCCAGGG + Intergenic
1040791417 8:51234355-51234377 ACCACTCAGGAAGTTACCCAGGG - Intergenic
1046857676 8:119052428-119052450 ACAACTCCTGCCATTACCCAAGG + Intronic
1046902659 8:119539620-119539642 ATTCCTCATGCTCTTACCCAAGG - Intergenic
1049519349 8:143080305-143080327 ACCACTCCTGCCCCACCCCAGGG + Intergenic
1049532474 8:143161141-143161163 TCTCCTCATGCCCTTTCCCAGGG - Intergenic
1050024413 9:1319310-1319332 CTCACTCCTGCCCTCACCCAAGG - Intergenic
1051768908 9:20555112-20555134 CCCAATCATCCCCTTCCCCAGGG + Intronic
1052433144 9:28392941-28392963 ACCATTCATAGCCTTACCCTTGG - Intronic
1055220110 9:73918923-73918945 ACCACTCCTGCACTTACCGCAGG + Intergenic
1057897346 9:98919881-98919903 GCTACTCAGGCCCTTCCCCAGGG + Intergenic
1060202076 9:121657146-121657168 GCCAACCATGCCCTTTCCCAGGG + Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1189874414 X:45420827-45420849 ACCACCCCTGCCCCTACCCCAGG - Intergenic
1199429352 X:147741294-147741316 CCCACTCATCACCTTTCCCAGGG + Intergenic