ID: 997612940

View in Genome Browser
Species Human (GRCh38)
Location 5:135227840-135227862
Sequence GAGCAGAGCAGACAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997612940_997612946 23 Left 997612940 5:135227840-135227862 CCTGCCAGCTGTCTGCTCTGCTC 0: 1
1: 0
2: 2
3: 49
4: 469
Right 997612946 5:135227886-135227908 TCACAGAGCTACAGTCACCAGGG No data
997612940_997612947 28 Left 997612940 5:135227840-135227862 CCTGCCAGCTGTCTGCTCTGCTC 0: 1
1: 0
2: 2
3: 49
4: 469
Right 997612947 5:135227891-135227913 GAGCTACAGTCACCAGGGATAGG No data
997612940_997612945 22 Left 997612940 5:135227840-135227862 CCTGCCAGCTGTCTGCTCTGCTC 0: 1
1: 0
2: 2
3: 49
4: 469
Right 997612945 5:135227885-135227907 GTCACAGAGCTACAGTCACCAGG 0: 1
1: 0
2: 1
3: 17
4: 154
997612940_997612944 -7 Left 997612940 5:135227840-135227862 CCTGCCAGCTGTCTGCTCTGCTC 0: 1
1: 0
2: 2
3: 49
4: 469
Right 997612944 5:135227856-135227878 TCTGCTCTCACAAGGGACTCTGG 0: 1
1: 0
2: 1
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997612940 Original CRISPR GAGCAGAGCAGACAGCTGGC AGG (reversed) Intronic
900188716 1:1344488-1344510 GGGCAGAGTGGACAGCAGGCAGG + Intronic
900228342 1:1543315-1543337 GAGCAGAGCATGCAGCTCTCCGG - Intronic
900505219 1:3026963-3026985 GACCAAAGCAAAGAGCTGGCTGG - Intergenic
900905130 1:5551791-5551813 GTGCAGAGCACACAGCAGGCAGG - Intergenic
901218292 1:7567031-7567053 GCTCAGAGCAGACAGCTGTTAGG + Intronic
901232966 1:7651461-7651483 GAGCAGAGGGGACAGGTAGCTGG + Intronic
901266536 1:7914654-7914676 GTGCAGAGTAGACACCTGGATGG + Intergenic
903221084 1:21870059-21870081 GAGCAGACCAGGCATCAGGCTGG + Intronic
904197838 1:28799321-28799343 GAGCAGTGCACACAGCAGACAGG - Intergenic
904684106 1:32248383-32248405 GCGCAGGACAGGCAGCTGGCAGG + Exonic
904972833 1:34432510-34432532 GAGCAGAGGAGCCTGATGGCTGG + Intergenic
905772874 1:40649701-40649723 GAGGAGAGGAGAAGGCTGGCAGG + Intronic
906285562 1:44585431-44585453 AAGCAGTGCAGACAGATGTCAGG - Intronic
906686497 1:47766475-47766497 GGGGAGAGCAGCCAGCAGGCAGG - Intronic
907234857 1:53037327-53037349 GAGCAGCTAAGCCAGCTGGCAGG - Intronic
907929095 1:58982422-58982444 GAGAAGGGCACACAGCTGGAGGG + Intergenic
908162819 1:61427711-61427733 CAGCAGAGAAGGCAGCTGGGAGG + Intronic
908468686 1:64420581-64420603 GAGATGAGGAGACAGCAGGCAGG - Intergenic
909748949 1:79134903-79134925 AAGCAGAGCAGAAGGCTGGGTGG + Intergenic
909859899 1:80592483-80592505 GAGCACAGCAGACACCTTGCTGG + Intergenic
910590519 1:88924707-88924729 GAGCACAGCAGACACCTTACCGG - Intergenic
910891064 1:92020789-92020811 GAGCAGAGCAGTCAGCAGCTGGG + Intergenic
911788244 1:101979214-101979236 GGGCAGAGTAGACAGCAGGTGGG - Intronic
913646935 1:120866164-120866186 GAGCAAGGCAGAGAGCAGGCTGG - Intergenic
914079710 1:144396700-144396722 GAGCAAGGCAGAGAGCAGGCTGG + Intergenic
914174610 1:145265237-145265259 GAGCAAGGCAGAGAGCAGGCTGG + Intergenic
914529338 1:148506725-148506747 GAGCAAGGCAGAGAGCAGGCTGG + Intergenic
915296703 1:154926371-154926393 GAGCAGAGCCGACAGCAGCGGGG - Exonic
915719669 1:157975492-157975514 GAGAAGAACAGACAGTTGACTGG + Intergenic
917294240 1:173502444-173502466 GGCCAGAGCAGACTGCTGGGTGG - Intronic
918038452 1:180897485-180897507 GAGCAGAGCAGAGCCCTGGGGGG - Intergenic
919082768 1:192886736-192886758 GAGCACAGCAGACACCCTGCTGG + Intergenic
920118538 1:203638311-203638333 CAGGAAAGCAGACAGGTGGCAGG - Intronic
920203136 1:204272983-204273005 GAGAAGAGCAGAAGGCAGGCTGG - Intronic
920808404 1:209257046-209257068 CAACAGAGCAGACAGCAGACGGG + Intergenic
920951263 1:210573696-210573718 GAGCAAAAGGGACAGCTGGCGGG - Intronic
921872596 1:220157054-220157076 GAGAAGAGCAGACAGCTGAGAGG + Intronic
923461853 1:234215094-234215116 GAGCAGGGCAGTCAGTTGGCTGG - Intronic
923629880 1:235642813-235642835 GAGCTGAGCAGAGGTCTGGCTGG - Intronic
924385698 1:243496531-243496553 GAGCAGAGCGGACAGCAGGGGGG + Intronic
924934463 1:248756356-248756378 GTGCAGAGCACACTGCAGGCAGG - Intergenic
1062849123 10:729412-729434 CAGCAGAGCAGCCAGATGACCGG - Intergenic
1063598814 10:7461728-7461750 AGGCAGAACAGACAGCAGGCGGG + Intergenic
1063607969 10:7539635-7539657 GAGAAGAGCAGATAGATGGTGGG + Intergenic
1064480819 10:15738885-15738907 GAACAGAGCGGAAAGCTGCCAGG - Intergenic
1064839198 10:19571890-19571912 GACCTGAGCAGAAAGCTGGCAGG - Intronic
1064987424 10:21225443-21225465 GAGAAGAACATAAAGCTGGCTGG - Intergenic
1065199849 10:23301951-23301973 GAGCACAGCAGACATCCTGCTGG + Intronic
1066179320 10:32944295-32944317 TAGCAGCGCTGCCAGCTGGCTGG + Intronic
1067497274 10:46772905-46772927 CAGCAGAGAAGGCGGCTGGCTGG + Intergenic
1067597378 10:47567510-47567532 CAGCAGAGAAGGCGGCTGGCTGG - Intergenic
1067772330 10:49135732-49135754 TTGCAGAGCAGAGAGATGGCAGG - Intergenic
1067784704 10:49236955-49236977 GAGCAGAGCTGTCAGCTGAATGG + Intergenic
1068100312 10:52544635-52544657 GAGCAGAGAAGACTCCTGGGAGG + Intergenic
1069526883 10:69180351-69180373 GGGCAGAGCAGATGGCTGCCCGG - Exonic
1070140726 10:73735120-73735142 CAGCAGAGAGGGCAGCTGGCCGG - Intergenic
1070148679 10:73792360-73792382 GAGCAGCGAAGACAGCTCCCTGG + Exonic
1070301649 10:75208473-75208495 GACCAGGCAAGACAGCTGGCTGG + Intergenic
1070340600 10:75494861-75494883 CAGCAGAGTAGAAAGCTGGAAGG - Intronic
1070428395 10:76311911-76311933 AAGCAGAGCCAACAGGTGGCAGG - Intronic
1070566117 10:77605081-77605103 GAACAAAGCAGCCAGCTGCCGGG + Intronic
1070595939 10:77833308-77833330 AAGCAGAACAGACTGCTGGATGG + Intronic
1070665770 10:78342381-78342403 GTGCAGAGCATAGAGCTGGCTGG + Intergenic
1073457242 10:103645076-103645098 TAGGAGAGCAGAACGCTGGCTGG - Intronic
1073485647 10:103817272-103817294 GAGCAGAAAAGACAACTGTCGGG - Intronic
1075049822 10:119175312-119175334 GTGAAGAGCAGGCAGCAGGCAGG + Intronic
1075474729 10:122724395-122724417 GAGCAGTGCACACAGCTGAATGG - Intergenic
1076002117 10:126920498-126920520 GAGCAGAAAAGACTGGTGGCAGG - Intronic
1076424309 10:130356654-130356676 GAGCACAGCAGACACCCTGCCGG - Intergenic
1077388993 11:2290625-2290647 CAGCAGGGCAGGCAGCTGGCTGG + Intergenic
1077546819 11:3175426-3175448 GAGCAGAGCTGAGAGGTGGGAGG - Intergenic
1077549943 11:3195740-3195762 GAGCAGAGGAGGCAGGTTGCAGG + Intergenic
1077935508 11:6781615-6781637 AAACAGATCAGACAGTTGGCAGG + Intergenic
1078787851 11:14513239-14513261 GAACAGAGCTTACAACTGGCAGG + Intronic
1079357722 11:19743803-19743825 GACCAGTCCAGACAGCTGCCTGG - Intronic
1079746752 11:24141986-24142008 GAGCAAAACAGCCAGCTGGCAGG + Intergenic
1079884274 11:25966500-25966522 GAGCACAGCAGACACCCTGCTGG + Intergenic
1080881472 11:36325300-36325322 GAGCACAGCAGACACCCTGCTGG + Intronic
1081784132 11:45734346-45734368 GAGCTGAGCAGAGAGCCAGCTGG - Intergenic
1081858031 11:46316256-46316278 GGGCACAGCAGTCAGCTGGCAGG - Intronic
1081874610 11:46400095-46400117 GAGCTGAGCAGAAAGCTGGAAGG - Intronic
1083304018 11:61753505-61753527 GAGCAGAGGTGACCGGTGGCAGG - Intronic
1084087893 11:66862940-66862962 GAGGAGAGCAGGGGGCTGGCGGG + Intronic
1084218318 11:67663471-67663493 GGCCAGGGCACACAGCTGGCAGG + Intronic
1084323868 11:68388064-68388086 GAGCACAGCAGGCAGAGGGCGGG + Intronic
1084400937 11:68942497-68942519 GAGCAAAGCCCAGAGCTGGCAGG - Intergenic
1084839033 11:71830361-71830383 TAGCAGAACAGAGAGCTGGAAGG + Intergenic
1084957316 11:72698200-72698222 GAGAAGAGAAGGCAGCTGGGTGG - Intronic
1085601979 11:77863281-77863303 GAGCACAGCAGACACCCTGCCGG + Intronic
1085759174 11:79227079-79227101 GAGATGAGCAGACAGCAGCCAGG + Intronic
1085803152 11:79610586-79610608 TGGCAGAGCTGACAGCTGGATGG + Intergenic
1086437994 11:86800507-86800529 GAGCAGCGCAGGCAGCTGGCGGG - Exonic
1086646220 11:89224065-89224087 GATGAGAGCAGGCAGCAGGCAGG + Intronic
1088879810 11:113964547-113964569 GAGCACAGCAGACAACCTGCTGG - Intergenic
1089626968 11:119757500-119757522 GAGCAGTGAGGACAGCAGGCAGG - Intergenic
1089643269 11:119861381-119861403 GAGCAGTCCAGACAGGGGGCAGG - Intergenic
1089874759 11:121709294-121709316 GACCAGACCAGACACCTTGCAGG - Intergenic
1090210803 11:124920064-124920086 GAGCAGGGCAGATGGGTGGCAGG + Exonic
1090407964 11:126488728-126488750 GAGGAGAGCAGTCACCTAGCAGG - Intronic
1090687752 11:129142322-129142344 GAACAGAGCAGACAGAAGGTAGG + Intronic
1090778309 11:129984402-129984424 GGGAAGAGCAGACAGATGGCAGG - Intronic
1091219533 11:133921756-133921778 GAGCACAGCAGAGAGGGGGCAGG - Intronic
1091241195 11:134053601-134053623 GCCCAGAGCAGAAAGCTTGCAGG + Intergenic
1091463445 12:663463-663485 GGAGAGAGCACACAGCTGGCGGG + Exonic
1092399639 12:8163739-8163761 TAGCAGAACAGAGAGCTGGAAGG - Intronic
1092404770 12:8212262-8212284 TAGCAGAGCAGAGAGCTGGAAGG - Intergenic
1092810498 12:12267349-12267371 GAGCGGGGCAGACGGCTGCCCGG - Intergenic
1093106651 12:15095400-15095422 GAGCACAGCAGACACCCTGCCGG + Intergenic
1094822042 12:34233611-34233633 GAGCAGAGAAGGCAGATGGTGGG + Intergenic
1095861167 12:46919278-46919300 GAGAAGAGCATACAACTGGCTGG + Intergenic
1096747631 12:53738890-53738912 GAGGAGAGCAGGCAGAGGGCAGG + Intergenic
1097466961 12:59938355-59938377 GAGAAGAGAAGACAGCAGGAGGG + Intergenic
1098022400 12:66169806-66169828 GAGCAGTGCAGACAAGCGGCTGG + Intronic
1098580987 12:72098780-72098802 CAGCAAGGCAGTCAGCTGGCTGG - Intronic
1098639866 12:72825576-72825598 GAGCACAGCAGACACCCTGCTGG + Intergenic
1099895378 12:88639627-88639649 GAGCAAAGCACACAGCTGCTGGG + Intergenic
1100113737 12:91277258-91277280 GAGCAGAGAGGACAACTGGCTGG - Intergenic
1100166550 12:91923883-91923905 GAGCAGGGCAGAGGACTGGCAGG - Intergenic
1102586032 12:113923687-113923709 GGGCAGAGCAGCCAGGCGGCGGG - Intronic
1102698246 12:114816769-114816791 GGGCAGGGGACACAGCTGGCTGG + Intergenic
1103335038 12:120183009-120183031 GAGCAGAGCAGACATGTGCCTGG - Intronic
1103703509 12:122859739-122859761 GAACAGAGCCGTGAGCTGGCTGG - Intronic
1103761264 12:123251837-123251859 GATCATAGCAGACAGGAGGCAGG - Intronic
1104066570 12:125311724-125311746 AAACAGGGCAGACAGCGGGCAGG + Intronic
1104202714 12:126607343-126607365 GAGCAGAACAGAAAGGTGGGTGG - Intergenic
1104787876 12:131461467-131461489 GAGGAGAGCTGACAGTTGCCAGG - Intergenic
1104832281 12:131761521-131761543 GAGAAGAGCAGGCAGCTCTCAGG + Intronic
1105026612 12:132853321-132853343 GAGCAGTGCAGACAGGAGGCGGG + Intronic
1105242612 13:18621260-18621282 GAGGATAGCAGAAACCTGGCAGG + Intergenic
1106619254 13:31357692-31357714 GAACAGAGCAAACATCAGGCTGG - Intergenic
1107006418 13:35616949-35616971 GTGCATTGCACACAGCTGGCTGG - Intronic
1107156416 13:37172346-37172368 GAGCACAGCAGACACCCTGCCGG + Intergenic
1107447414 13:40481264-40481286 GACCAGAGCAGCCAGGTGGAGGG + Intergenic
1107886825 13:44880666-44880688 GAGCTGTGTAGACACCTGGCGGG - Intergenic
1108708386 13:53010462-53010484 GAGCAGAGCAGGTAGCAGGATGG + Intergenic
1110201194 13:72851939-72851961 GAGCTGAGCAGACAGTGGGATGG + Intronic
1110615394 13:77535960-77535982 GAGCAGAGCTAACAGCCAGCTGG - Intronic
1110665237 13:78109081-78109103 AAGCAGAACAGACAGAGGGCAGG - Intergenic
1111021455 13:82457742-82457764 GAGCACAGCAGACACCCTGCCGG - Intergenic
1111100900 13:83584889-83584911 GAGCACAGCAGACACCCTGCTGG + Intergenic
1111174773 13:84580070-84580092 GAGCACAGCAGACACCCTGCCGG + Intergenic
1112433667 13:99375214-99375236 GAGCAGCCCAGAACGCTGGCAGG + Intronic
1112864773 13:103880704-103880726 AAGCACAGCAGAAAGCTGCCAGG - Intergenic
1113308957 13:109111014-109111036 GTTCAGAGCAGACAGATGGTAGG + Intronic
1113896619 13:113768585-113768607 GAGCAGGGCAGACCGTTAGCAGG - Intronic
1114384836 14:22243840-22243862 GAGCACAGCAGACACCCTGCCGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114638690 14:24204311-24204333 GAGTGGAGCAGAAGGCTGGCGGG + Intronic
1114840852 14:26260642-26260664 GAGCACAGCAGACACCCTGCCGG - Intergenic
1116605611 14:46989763-46989785 TGGCAGAGGAGACAGCTGGCAGG + Intronic
1117171822 14:53108185-53108207 GAGCACAGCAGACACCCTGCCGG - Intronic
1118821430 14:69348788-69348810 TAGCACAGAAGAGAGCTGGCTGG - Intronic
1119603436 14:75993710-75993732 TAGCAGAGCAGGAAGCTGGAAGG - Intronic
1120397395 14:83985641-83985663 GAGCACAGCAGACACCCTGCCGG - Intergenic
1121017797 14:90558889-90558911 GAGCAGAGGTGACAGCAGACAGG + Intronic
1121457330 14:94046813-94046835 GAGCAGAGCAGACGCTTTGCAGG + Exonic
1122138677 14:99649287-99649309 GGGCAGAACAGACATCTGGAAGG - Intronic
1122406749 14:101505369-101505391 TGGCAGAGCCGGCAGCTGGCTGG + Intergenic
1122637865 14:103138706-103138728 GTGCAGATCCAACAGCTGGCGGG - Intergenic
1123488686 15:20763347-20763369 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1123545182 15:21332420-21332442 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1124102960 15:26712795-26712817 GACCACAGCAAACAGCTGGGAGG + Intronic
1124217877 15:27824698-27824720 GAGCAGAGCTAGCAGCTGGCCGG - Intronic
1124716316 15:32065773-32065795 GGGCAGAGCTGTCAGCTGCCTGG + Intronic
1124716338 15:32065926-32065948 GGGCAGAGCTGTCAGCTGCCTGG + Intronic
1126156857 15:45574057-45574079 GAGCAGGGCAGACATCAGGATGG - Intergenic
1126728329 15:51655575-51655597 GAGCACAGCAGACACCCTGCCGG + Intergenic
1127074506 15:55312176-55312198 GAGCACAGCAGACACCCTGCTGG + Intronic
1128135235 15:65258278-65258300 GAGCAGAGAATACAGCAAGCAGG + Exonic
1128271681 15:66315945-66315967 GAGAAGAGCAGCCAGCAGGGTGG - Intronic
1128710575 15:69868426-69868448 TGGCAGAGCAGAGAGCTGGAAGG - Intergenic
1129194424 15:73955645-73955667 CAGCAGAGGCGACACCTGGCAGG + Intergenic
1129237089 15:74230144-74230166 GAGCAGACCAGGAGGCTGGCAGG + Intergenic
1129605575 15:77023405-77023427 GAGCAGGGCTGACAGGTGGGAGG + Intronic
1129683045 15:77669086-77669108 TAGCAGAGCAGAAACCTGGGAGG + Intronic
1129974821 15:79813289-79813311 GAGCAGAGAGGACAACTGCCTGG - Intergenic
1132416048 15:101619631-101619653 GTGGAAAGCAGACAGATGGCAGG + Intergenic
1202953528 15_KI270727v1_random:59691-59713 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1132814572 16:1819618-1819640 GAGCACAGCACACAGGTGGGAGG - Intronic
1133018779 16:2956760-2956782 GGGCGGGGCAGACAGCAGGCTGG + Intergenic
1137717782 16:50609440-50609462 GACCAGGGCAGACAGCTGGCTGG + Intronic
1137930165 16:52579622-52579644 GAGCATGACAGACAGCTGGGGGG - Intergenic
1138967451 16:62101974-62101996 AAGCAGAGCAGAAAGCTCTCTGG - Intergenic
1140481070 16:75263195-75263217 AAGCAGAACAGACAGCAGGGAGG + Intronic
1140874595 16:79138882-79138904 GAGCAGAGAGCACAGCAGGCTGG + Intronic
1141201733 16:81903528-81903550 GAGAAGTGCAGCCACCTGGCTGG + Intronic
1141348296 16:83268932-83268954 GACCAGAGCAGAGAGATGGGAGG + Intronic
1141573192 16:84947250-84947272 CAGCTGAGCAGGCAGCAGGCAGG - Intergenic
1141607478 16:85162850-85162872 GAGCTGAGCACACAGCAGGGCGG + Intergenic
1141715093 16:85722436-85722458 GAGCGGAGCAGACTGAAGGCTGG + Intronic
1142157134 16:88537702-88537724 GAGCAGGGCAGGCAGCTTCCTGG - Intergenic
1142275269 16:89115071-89115093 GAACAGAGCCCACAGCTGGGGGG + Intronic
1142964982 17:3574958-3574980 GAGCACAGGAGCCAGCTGGAAGG + Intronic
1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG + Intronic
1144274395 17:13651761-13651783 CAGCACACCAGAGAGCTGGCTGG - Intergenic
1144625952 17:16844566-16844588 AAGGAGAGGAGGCAGCTGGCTGG + Intergenic
1144644461 17:16962788-16962810 GAGCAGAGCCGGCAGCCAGCAGG + Intronic
1144880483 17:18428154-18428176 AAGGAGAAGAGACAGCTGGCTGG - Intergenic
1145151752 17:20516233-20516255 AAGGAGAAGAGACAGCTGGCTGG + Intergenic
1145204725 17:20977076-20977098 GAGCAGAGCTGGCAGCCAGCAGG - Intergenic
1146096125 17:29931504-29931526 GTGCAGAGAAGCCAGCTGGTAGG + Intronic
1146786317 17:35725034-35725056 GAGCAGATCAGAGAGCTGAAGGG - Intronic
1147263814 17:39223599-39223621 CAGCTGAGCAGGCAGCTTGCTGG + Intronic
1147562220 17:41516234-41516256 GAGTTCAGCAGCCAGCTGGCCGG - Exonic
1147580101 17:41623264-41623286 AAGGAGAAGAGACAGCTGGCTGG + Intronic
1147603576 17:41760904-41760926 GGGCACAGGAGCCAGCTGGCAGG - Intronic
1148625876 17:49068609-49068631 GTGCACAGCAGACAGCTGTTTGG - Intergenic
1150759463 17:67948203-67948225 GAGCAGAGCTGACAGCTTAGTGG - Exonic
1151824950 17:76519050-76519072 GAGCAGTGAGGACAGATGGCAGG - Intergenic
1151978823 17:77497476-77497498 GGGCAGGGCAGGCAGGTGGCAGG - Intronic
1152022944 17:77790614-77790636 GGGAAGAGGAGACAGGTGGCTGG + Intergenic
1152162104 17:78675271-78675293 GAGGAGAGGAGAGAGCTGACTGG - Exonic
1152199803 17:78938738-78938760 GGGCAGAAAACACAGCTGGCGGG + Intergenic
1153952465 18:10068911-10068933 AAGGAGAGCAGAGAGCTGCCTGG - Intergenic
1154412262 18:14147900-14147922 GTGCAGAGCACACAGGTGCCAGG + Intergenic
1155193693 18:23453395-23453417 GAACAGAGCAGAGAGGTGGCAGG - Exonic
1157237476 18:45978223-45978245 GTGCAGAGCAACCAGGTGGCAGG + Intergenic
1157447451 18:47756033-47756055 GAGGAGAACAGACAGGTAGCAGG + Intergenic
1158152306 18:54387027-54387049 GAGCACAGCAGACACCCTGCTGG - Intergenic
1158546504 18:58402390-58402412 GGGCAGAGGAGATAGCTAGCGGG + Intergenic
1160511572 18:79456128-79456150 GAGCTTAGCTGGCAGCTGGCAGG + Intronic
1160582931 18:79898016-79898038 GAGGGGAGAAGACAGCTGGCAGG - Intronic
1161089975 19:2354866-2354888 GAGCAGAACTGAGAGCTGGCAGG + Intergenic
1161417405 19:4155115-4155137 GAGCTGAGCAGAGCTCTGGCTGG - Intronic
1161479175 19:4502079-4502101 GAGCAGAGCAGAGAACTGTGGGG + Exonic
1161512370 19:4678938-4678960 GAGCAGAGCATAGAGTTGGGCGG - Intronic
1161684730 19:5697149-5697171 GGGCAGAGCACAGAGCTTGCAGG - Intronic
1161940118 19:7397143-7397165 AAAAAGAGCAAACAGCTGGCAGG + Intronic
1162520071 19:11174416-11174438 GGGCATGGCGGACAGCTGGCTGG + Intronic
1162805462 19:13135920-13135942 GAGCAGGGCAGCCAGCCGGTGGG + Exonic
1163476104 19:17527043-17527065 TGGCAGGGCAGACATCTGGCAGG - Intronic
1163508515 19:17721885-17721907 GAGCAGAGCAGCAGGCGGGCAGG + Intronic
1164173182 19:22745581-22745603 GAGCACAGCAGACACCCTGCTGG - Intergenic
1164445124 19:28310587-28310609 GAGCAGAATGGACAGTTGGCAGG - Intergenic
1164610197 19:29626599-29626621 GAGGAGAGGAGGCAGCTGCCTGG - Intergenic
1166253580 19:41587046-41587068 CAGCTGAGCACTCAGCTGGCTGG - Intronic
1166346890 19:42172136-42172158 GAGAAAAGCAGACTGGTGGCAGG - Intronic
1168137667 19:54361979-54362001 GAGCGGGGCAGAGAGCTGGCAGG + Intronic
1168160403 19:54507099-54507121 GAGCGGGGCAGAGAGCTGGCAGG - Intronic
925068992 2:951242-951264 GAGCAGAGCGGCCAGGGGGCGGG - Intronic
925862417 2:8192658-8192680 GAACAGAACTCACAGCTGGCAGG + Intergenic
925978006 2:9154668-9154690 GAGCAGAGCACACAGCTACATGG - Intergenic
926313503 2:11692646-11692668 AAGCAGAGGAGACAGCAGGTGGG - Intronic
927436049 2:23067539-23067561 GAGCTGAGCACAGAGATGGCTGG - Intergenic
927940887 2:27102167-27102189 GACCAGAGTGGACAGCTGGATGG - Exonic
928178476 2:29051094-29051116 TGGCAGACAAGACAGCTGGCAGG - Intronic
928603965 2:32927152-32927174 GAGCACAGCCCACAGCTGTCAGG - Intergenic
928607176 2:32953662-32953684 AAGCAGAGCAGGCAGGGGGCGGG - Intronic
928940372 2:36721378-36721400 GAGCAGAGGAGAGAGATGGCAGG - Intronic
929578216 2:43066018-43066040 GGGCAGGGGAGCCAGCTGGCGGG + Intergenic
929782706 2:44967521-44967543 AAAAAGAGCAGACAGCAGGCAGG + Intergenic
931038990 2:58275811-58275833 GAGCACAGCAGACACCTTGCCGG - Intergenic
931942772 2:67271356-67271378 GTGCAGAACAAACAGCTGGAGGG + Intergenic
932917187 2:75872114-75872136 GAGCACAGCAGACACCCTGCCGG - Intergenic
933175723 2:79170157-79170179 GAGCACAGCAGACACCCTGCTGG + Intergenic
933500216 2:83101825-83101847 GAGCACAGCAGACACCCTGCTGG - Intergenic
933725983 2:85427530-85427552 GAGCAGAGCAGGGAGGTGGCTGG + Intronic
933780427 2:85796951-85796973 GAGCAGAGAAGGCAGCTGACAGG - Intergenic
933900540 2:86846583-86846605 GAGCAGAGCAGATGGCAGCCTGG - Intronic
934927948 2:98395005-98395027 GGACAGAGCAGGCAGCAGGCAGG - Intronic
935780007 2:106502642-106502664 GAGCAGAGCAGATGGCAGCCTGG + Intergenic
936387728 2:112044787-112044809 GAGCGCAGCAGACAGCCTGCTGG + Intergenic
937315353 2:120928474-120928496 GAGGAGAGCTCAGAGCTGGCTGG - Intronic
937649151 2:124300493-124300515 GAGCAGAGAATAGAGCAGGCTGG + Intronic
938341985 2:130541776-130541798 GAGGAGAGCAGAGAGCAGGAGGG + Intronic
938347847 2:130578935-130578957 GAGGAGAGCAGAGAGCAGGAGGG - Intronic
938509522 2:131925967-131925989 CAGAAGAGCAGACGGATGGCAGG + Intergenic
939134075 2:138273459-138273481 GAGCACAGCAGACACCCTGCTGG + Intergenic
939841840 2:147198729-147198751 GAGCAGAGAAGGCAGATGACGGG - Intergenic
942446048 2:176079861-176079883 GAGAAGGGCAGACGGCTGGGTGG + Exonic
943876654 2:193074571-193074593 GAGCAGTGCAGAAAGGGGGCTGG - Intergenic
945431111 2:209766832-209766854 GAGCAGAGGAGAACTCTGGCTGG - Intergenic
946405089 2:219488267-219488289 GTGCAGGGCAGGCCGCTGGCAGG - Exonic
948157362 2:235794075-235794097 GAGCAGAGCAGGCAGGTGCCTGG - Intronic
948236990 2:236398703-236398725 GAGCATAGCTGTCATCTGGCTGG - Intronic
948756991 2:240165699-240165721 GAGCACAGCAGGCAGCAGGCAGG + Intergenic
949055554 2:241926434-241926456 AGGCAGAGCTGACAGCTGGGAGG + Intergenic
1168806243 20:673961-673983 GAGCAGGGCTGAGGGCTGGCAGG - Intronic
1168992751 20:2108623-2108645 GAGTAGAGCAGAGAGCAGGTGGG - Intronic
1169275955 20:4233930-4233952 GAGCAGCCCAGCCAGCTGGATGG - Intronic
1169315369 20:4586005-4586027 GAGAAGAGAAGGAAGCTGGCTGG + Intergenic
1170305558 20:14934175-14934197 CAGAAGGGCAGACAGATGGCTGG - Intronic
1171457211 20:25278815-25278837 CAGCAGAGCACACAGCTGTAGGG + Intronic
1172643436 20:36455430-36455452 GTGCAGAGAATGCAGCTGGCAGG - Intronic
1173285207 20:41664607-41664629 TGGCAGAGCAGAAAGCTGGAAGG - Intergenic
1174354132 20:49987217-49987239 GAGGAAAGCAGGCTGCTGGCCGG + Intronic
1175148534 20:56914726-56914748 TACAAAAGCAGACAGCTGGCAGG + Intergenic
1175738833 20:61406381-61406403 GGGCAGAGCAGACAGTGGTCCGG - Intronic
1175739646 20:61411788-61411810 GATCAGAGTGGGCAGCTGGCCGG + Intronic
1176169607 20:63690906-63690928 GAGCACAGCGAACAGCGGGCGGG + Exonic
1176181707 20:63752515-63752537 GGGCAGAGCAGACAGGGGCCCGG + Intronic
1176653464 21:9570411-9570433 ATGCAGAGCAGACAGAAGGCAGG - Intergenic
1176872554 21:14095478-14095500 GAGCAGAGAAGGCAGTTGGTGGG + Intergenic
1177262999 21:18753065-18753087 GAGCACAGCGGACAGCCTGCCGG + Intergenic
1177359347 21:20048589-20048611 GAGCACAGCAGACACCGTGCCGG + Intergenic
1177714735 21:24824383-24824405 GAGCAAAACAGAAAGCTGGAAGG - Intergenic
1178087870 21:29130770-29130792 GAGGAGCGGAGACAGCTGTCAGG - Intronic
1178696463 21:34796952-34796974 GGGCAGAGCACAAAGCTGTCGGG + Intronic
1178721049 21:35009318-35009340 AAGCAGAGAAGACATCGGGCAGG - Intronic
1178829066 21:36040064-36040086 GAGCAGGACTGACAGCAGGCAGG + Intronic
1179225877 21:39452663-39452685 GACCAGAGCAGACATCTCTCAGG + Intronic
1180005848 21:45020130-45020152 GAGCAGGGCAGCCACCTGCCTGG + Intergenic
1180975548 22:19845960-19845982 GATCAGACCAGAGAGCAGGCGGG + Intronic
1182771793 22:32801701-32801723 GCGCAGAGCGGGCAGCAGGCAGG + Exonic
1183455675 22:37921964-37921986 GAGCACCGCCGACACCTGGCAGG - Exonic
1183678716 22:39314336-39314358 GGTCAGAGCAAAAAGCTGGCTGG + Intronic
1184499160 22:44861549-44861571 GGGCAGAGCAGAGAACTGGAGGG - Intronic
1184550549 22:45202243-45202265 GAGCAAAGCAGCCAGTGGGCTGG + Intronic
1184708937 22:46236464-46236486 GAGTGGAGCAGGAAGCTGGCGGG - Exonic
1185150887 22:49163459-49163481 GATCGGGGCAGACGGCTGGCTGG + Intergenic
1185223427 22:49640303-49640325 GACCAGAGCTGACATGTGGCTGG + Intronic
1185316283 22:50180598-50180620 TAGGAGAACAGAGAGCTGGCGGG + Intergenic
949863784 3:8530385-8530407 GAGCAGAGCAGAGCACTCGCCGG - Intronic
950043564 3:9934956-9934978 CAGCAGAGCAGAGATTTGGCGGG - Intronic
950099628 3:10348839-10348861 GAGCAGGGCTGGCACCTGGCAGG + Intronic
950453448 3:13078664-13078686 CAGCAGAGCACGCAGCTGGATGG - Intergenic
951107711 3:18764825-18764847 GCAAAAAGCAGACAGCTGGCTGG + Intergenic
951195196 3:19815760-19815782 GAGCCAAGCAGAGAGCTGGGAGG + Intergenic
952644624 3:35639988-35640010 CAGAAGAGCAGACAGGAGGCGGG + Intronic
953434477 3:42867673-42867695 GAGCCAAGCAGACAGCTGAGAGG - Intronic
953545598 3:43861843-43861865 GAGCAGAGCAGGCAGGAGGCAGG - Intergenic
953670559 3:44958769-44958791 GATCAGAGCAGAAAGCATGCTGG - Intronic
954037166 3:47857351-47857373 CAGCTGGGCAGCCAGCTGGCTGG - Intronic
954194056 3:48985755-48985777 GAGGAGAGCGGAAAACTGGCAGG - Exonic
954988216 3:54814397-54814419 AAGCAGAGCAGGTATCTGGCTGG + Intronic
955107070 3:55908606-55908628 TAGAAGAGCAGGCAGCTGGCCGG + Intronic
956688434 3:71854303-71854325 GCACAGAGCAGAAAGCTAGCTGG + Intergenic
956835798 3:73095159-73095181 AAGCTGAGCAGAAAGCAGGCGGG - Intergenic
957879969 3:86199743-86199765 GAGGAGATCACACAGCAGGCAGG - Intergenic
958091883 3:88886779-88886801 GAGCACAGCAGACACCCTGCCGG + Intergenic
961470042 3:127105808-127105830 GAGCAGAGCAGGGGGCTCGCAGG - Intergenic
961824155 3:129590036-129590058 GGTCAGAGCAGACACCCGGCAGG - Intronic
962259085 3:133891826-133891848 GGGCAGGGCAGGCAGGTGGCTGG + Intronic
963255693 3:143142545-143142567 GAGCACAGCAGGCACCTTGCCGG - Intergenic
964013483 3:151918879-151918901 GAGTAGAGCAGAAAGCTTGCTGG + Intergenic
965183592 3:165435411-165435433 AAGAAGAGCAGACAGGTGGTGGG + Intergenic
965200531 3:165652043-165652065 GGGCTGAGGAGACAGGTGGCTGG - Intergenic
966160108 3:176958790-176958812 TAACAGAGCAGACAGCTGGAAGG + Intergenic
966609034 3:181850036-181850058 GAGCACACCTGACAGATGGCAGG + Intergenic
967205504 3:187116918-187116940 GAGAAGAGAAGACAGCTGTGAGG + Intergenic
968152179 3:196345617-196345639 GAGAAGGCCAGTCAGCTGGCAGG + Intergenic
968531343 4:1093578-1093600 AGGCAGAGCAGACAGGTGGCTGG + Intronic
968728328 4:2258488-2258510 GAGCAGGGAAGGCAGGTGGCTGG - Intronic
968772401 4:2516086-2516108 GAGCTGAGCAGACAGCTCCTTGG - Intronic
969288432 4:6222582-6222604 TAGCAGAGCAGTCAGATGGAAGG - Intergenic
969616792 4:8257873-8257895 GAGCCCAGCAGAAAGCTGGTTGG - Intergenic
969761354 4:9185754-9185776 TAGCAGAGCAGAGAGCTGGAAGG + Intergenic
969780454 4:9397862-9397884 TAGCAGAACAGAGAGCTGGAAGG + Intergenic
970738103 4:19198081-19198103 GAGCACAGCAGACACCCTGCTGG + Intergenic
971013940 4:22468233-22468255 GAGCAGAGCAGCCTGCTGTGGGG - Intronic
971240207 4:24881485-24881507 AAGCACAGCAGACAACTGCCTGG + Intronic
971623398 4:28886542-28886564 TGCCAGGGCAGACAGCTGGCAGG - Intergenic
971763727 4:30802915-30802937 GAGGAGAGCAAACAGATGGTAGG + Intronic
972165410 4:36277681-36277703 CAGCAGAGCAGAGAACTGGAGGG - Intergenic
973245867 4:48010779-48010801 GAGCACAGCACACACCTTGCCGG + Intronic
973707165 4:53592390-53592412 CACCAGAGCAGGCAGCTGGGAGG + Intronic
974433156 4:61824561-61824583 GCCTGGAGCAGACAGCTGGCTGG + Intronic
975680058 4:76867533-76867555 GATCATAGCAGACAGAAGGCAGG + Intergenic
976561511 4:86506830-86506852 CAGCAGAGGAGAAAGCTGTCAGG + Intronic
978587016 4:110284242-110284264 GAGCACAGCAGACACCCTGCCGG + Intergenic
978599650 4:110414316-110414338 GAGCAGTGGTGCCAGCTGGCAGG - Intronic
978715545 4:111838517-111838539 GGCCAGAGCAGAAAGCTGGAGGG - Intergenic
981740770 4:147999494-147999516 GAGCACAGCAGACACCCTGCCGG - Intronic
982978795 4:162104128-162104150 GAGCACAGCAGATACCTTGCTGG - Intronic
983777806 4:171629940-171629962 GAGCACAGCAGACACCCTGCCGG - Intergenic
984257766 4:177408236-177408258 GAGCACAGCAGGCACCGGGCTGG + Intergenic
984272749 4:177567658-177567680 GAGCAGAGAAGAGAGATGGCTGG + Intergenic
985120044 4:186631218-186631240 GAGCAGAGGGGTCAGCTGGGAGG - Intronic
985120083 4:186631442-186631464 GAGCAGAGGAGTCACCTGGACGG - Intronic
985120108 4:186631610-186631632 GAGCACAGGAGTCAGCTGGGAGG - Intronic
985120117 4:186631666-186631688 GAGCAGAGGAGTCAGCTGGGCGG - Intronic
985796769 5:1968014-1968036 GGGCAGAGTAGACAGCTCCCAGG - Intergenic
986288402 5:6378229-6378251 GACCAGACCAGAGGGCTGGCGGG + Intronic
986433409 5:7704271-7704293 GAGAAGAGCAGGCAGCTGTCTGG - Intronic
988738051 5:34042538-34042560 CAGCATAGCAGGAAGCTGGCTGG + Intronic
989978172 5:50609550-50609572 GAGCAGGGCAGAGAGCAGGCTGG - Intergenic
990821027 5:59840453-59840475 GAGCAGTGCTGACACATGGCAGG + Intronic
992610588 5:78504962-78504984 GAAGATAGCAGGCAGCTGGCCGG + Intronic
992941958 5:81771380-81771402 GAGCAAAGAGGACATCTGGCGGG + Intergenic
993054977 5:82970928-82970950 GAGCACAGCAGACACCCTGCTGG + Intergenic
993143874 5:84069913-84069935 CAGAAGAGCACACAGGTGGCTGG + Intronic
994442023 5:99819785-99819807 GATCAGAGCAGATAGCAGGTAGG - Intergenic
995465177 5:112444134-112444156 GAGCACAGCAGACACCCTGCTGG - Intergenic
995546097 5:113233048-113233070 TAGCAAAGCAGCCAGCAGGCAGG + Intronic
996321998 5:122229184-122229206 GAGCACAGCAGACACCCTGCGGG + Intergenic
996939802 5:128990882-128990904 AAGCAGAGCAGACACCCTGCTGG + Intronic
997234061 5:132262582-132262604 GAGCAGACAAGCCAGATGGCTGG - Intronic
997608475 5:135193366-135193388 GGACAGGGCAGCCAGCTGGCTGG - Intronic
997612940 5:135227840-135227862 GAGCAGAGCAGACAGCTGGCAGG - Intronic
998248159 5:140528901-140528923 GTGCAGAGGAGACAGAAGGCAGG - Exonic
999778098 5:154827006-154827028 GAAAAGAGTAGACAGATGGCCGG + Intronic
1000008678 5:157211560-157211582 GACAAGAACAGACAGCAGGCTGG - Intronic
1000015536 5:157272351-157272373 TAGCAGTTCAGACACCTGGCCGG - Intronic
1001424208 5:171612872-171612894 GAGCAGAGGAGCCAGCAGGCTGG - Intergenic
1001778591 5:174348026-174348048 GAGCAGGGCAGACAGGTGCACGG + Intergenic
1002452074 5:179324929-179324951 TAGCAGAGCAGACAGTGGGGGGG - Intronic
1002465454 5:179406106-179406128 CAGCAGAGCAGGCTGTTGGCAGG + Intergenic
1002898473 6:1392529-1392551 GAGCAGGGAGGGCAGCTGGCAGG - Intronic
1003472738 6:6452181-6452203 GAACAGATCAGAAAGTTGGCTGG + Intergenic
1004061794 6:12205075-12205097 GATGAGATCACACAGCTGGCAGG + Intergenic
1004787499 6:18985362-18985384 GAGCAGGGCAAATAGCTGGTTGG + Intergenic
1005029016 6:21492164-21492186 GAGCAGAGCAATCACCTGGTTGG - Intergenic
1005036484 6:21559874-21559896 GAACAGAGAAGACAGATGGTTGG - Intergenic
1006211770 6:32401449-32401471 GATGACAGCAGACAGCTGGCCGG - Intronic
1006942729 6:37763580-37763602 GGGCTGAGCTGACAGCTGTCAGG + Intergenic
1007288442 6:40765434-40765456 CAGCTGTGCTGACAGCTGGCAGG - Intergenic
1008139011 6:47810330-47810352 GAGAAGAGCAGACGGGTGGATGG + Intronic
1011540380 6:88421299-88421321 GAGCACAGCAGACACCCTGCCGG + Intergenic
1014432473 6:121387566-121387588 GAGCAGAGCAGAGGATTGGCAGG - Intergenic
1014574592 6:123054418-123054440 AGGCAGAGCAAACAGCTGTCTGG - Intronic
1015202263 6:130596147-130596169 CAGCAGAGCAGAAAGCTAGAGGG - Intergenic
1015326161 6:131926183-131926205 GGGCAGAGCAGAGAGGTAGCAGG - Intergenic
1016887648 6:148972633-148972655 GAGCTCAGCTGACAGGTGGCCGG - Intronic
1016990035 6:149922504-149922526 GAACAGAGCAGGCTGGTGGCTGG + Intronic
1016993014 6:149942558-149942580 GAGCAGAGCAGGCCTGTGGCTGG - Intronic
1017005321 6:150024964-150024986 GAGCAGAGCAGGCTTGTGGCTGG + Intronic
1018091167 6:160348044-160348066 CTGCAGAGCAGGCTGCTGGCAGG + Intergenic
1018186702 6:161271383-161271405 GAGCAGAGCACCCAGCTGGAAGG - Intronic
1018420180 6:163634360-163634382 GAGCAGAGAACACAGCGGGATGG - Intergenic
1018741098 6:166729184-166729206 CAGCAGAGGTGACAGCTGGAAGG - Intronic
1018790317 6:167143296-167143318 GAGCAGAGCAAACAGCTAACGGG - Intergenic
1019076931 6:169395283-169395305 GAGAAGGGCAGGCAGGTGGCAGG - Intergenic
1019347009 7:536050-536072 GAGCAGAGCTGTGACCTGGCTGG - Intergenic
1019587398 7:1813013-1813035 GAGCAGAGCCGCCTGCCGGCCGG + Intergenic
1019670683 7:2276474-2276496 CAGCAGAGCAGACGGCAGGGAGG + Intronic
1020143346 7:5624362-5624384 GAGCATGGCAGGCAGCTGCCTGG + Intronic
1020153663 7:5703611-5703633 AAGCAGGGAAGAAAGCTGGCAGG + Intronic
1021030241 7:15724014-15724036 GAGAAGTACAGCCAGCTGGCTGG + Intergenic
1021107195 7:16651561-16651583 GTGCAGAGGAAACTGCTGGCTGG + Intronic
1021774788 7:24042204-24042226 GAACAGAGCAGTCAGCTGCCTGG + Intergenic
1023457858 7:40361216-40361238 GAGCAGATTAGACTGCTGACTGG - Intronic
1024886654 7:54149743-54149765 GAACAGAGCAGACAGAAGCCTGG + Intergenic
1025186860 7:56867363-56867385 GAGAACAGCAAACAGCTAGCAGG + Intergenic
1025620700 7:63167537-63167559 GAGCAGTGGTGCCAGCTGGCAGG - Intergenic
1025685062 7:63709549-63709571 GAGAACAGCAAACAGCTAGCAGG - Intergenic
1027261233 7:76465951-76465973 GAGCAGGGCAGGCAGCTGCTAGG + Intronic
1027312617 7:76964059-76964081 GAGCAGGGCAGGCAGCTGCTAGG + Intergenic
1027868353 7:83675015-83675037 GAGCACAGCAGACACCCTGCCGG + Intergenic
1028013996 7:85684166-85684188 GAGCACAGCAGACACCCTGCTGG - Intergenic
1028284768 7:88982190-88982212 GAGTATAGAAGACCGCTGGCTGG - Intronic
1029055944 7:97742914-97742936 CAGGAGATCAGACAGCTGGGTGG - Intergenic
1030208384 7:106972718-106972740 GAGCGCAGCAGACACCTGGCCGG + Intergenic
1030617597 7:111754680-111754702 GAACAGCACAGACAGCTGGGTGG + Intronic
1031299586 7:120047525-120047547 GAGCACAGCAGACACCCTGCCGG - Intergenic
1031742814 7:125455884-125455906 GAGCACAGCAGACACCCTGCCGG + Intergenic
1032080951 7:128858207-128858229 CAGCAAAGCAGGCAGGTGGCGGG + Exonic
1032091297 7:128912953-128912975 CAGCAAAGCAGGCAGGTGGCGGG - Intergenic
1032760018 7:134931989-134932011 GAGAAAAGAAGACAGGTGGCTGG - Intronic
1033544697 7:142389328-142389350 GAGCACAGCAGACAGCCTGGAGG - Intergenic
1034257793 7:149733955-149733977 GAGCCGAGCAGCCTGCTGGGAGG + Exonic
1034502563 7:151460313-151460335 GAACACAACAGCCAGCTGGCAGG - Intergenic
1034683341 7:152947836-152947858 GAGCATGGCAGACAGGAGGCAGG - Intergenic
1035578580 8:725225-725247 GAACAGAGCAGACAGGAAGCCGG - Intronic
1035604631 8:921701-921723 GAGCAGCGCAGCCACCTGGGTGG - Intergenic
1035983136 8:4395197-4395219 GAGAACATCAGACATCTGGCTGG + Intronic
1036271452 8:7307587-7307609 TAGCAGAGCAGAGAGCCGGAAGG + Intergenic
1036349896 8:8002762-8002784 TAGCAGAGCAGAGAGCCGGAAGG - Intergenic
1036838988 8:12100861-12100883 TAGCAGAACAGAGAGCTGGAAGG - Intergenic
1036845168 8:12163288-12163310 TAGCAGAGCAAAGAGCTGGAAGG - Intergenic
1036860777 8:12347104-12347126 TAGCAGAACAGAGAGCTGGAAGG - Intergenic
1036866537 8:12405611-12405633 TAGCAGAGCAAAGAGCTGGAAGG - Intergenic
1037687833 8:21158741-21158763 GTGCTGAGCAGAGGGCTGGCTGG + Intergenic
1038021507 8:23555105-23555127 GTGCAGAGAAGACAGCAGTCAGG - Intronic
1038656738 8:29459620-29459642 GAACAGAGTCGACAGCAGGCAGG - Intergenic
1038715601 8:29988028-29988050 CAGCAGCACAGGCAGCTGGCAGG + Intergenic
1039578517 8:38644942-38644964 GAGCGGTGCAGACAGAGGGCTGG + Intergenic
1039990632 8:42484834-42484856 AAGCAGAACACCCAGCTGGCTGG - Intronic
1040559916 8:48514799-48514821 GAGCAGACCAGGCCGGTGGCGGG - Intergenic
1040768441 8:50944246-50944268 GAGCACAGCAGACACCCTGCTGG + Intergenic
1040804406 8:51377907-51377929 GAGCAGAGCAGGGGACTGGCAGG + Intronic
1041001955 8:53462575-53462597 GAGCAGACCAGTCACCTGGTAGG + Intergenic
1041333837 8:56757686-56757708 GAGTCAGGCAGACAGCTGGCAGG + Intergenic
1041382627 8:57266840-57266862 CTGCAGAGCTGACAGCTGGAGGG + Intergenic
1041741905 8:61165183-61165205 GAGCATAGCAGACACCCTGCTGG + Intronic
1044257564 8:90082995-90083017 GAACAGAGCAGAAAACTGGAAGG - Intronic
1045320642 8:101079522-101079544 GAGGAAACCAGACAGCTGGGGGG + Intergenic
1048856832 8:138693574-138693596 GAGCAGAGCAGACACTGGGCGGG + Intronic
1049126473 8:140793873-140793895 GAGCCGTGCACACAGCTGGCTGG + Intronic
1049289984 8:141796706-141796728 GAGGGGAGCAGGCAGCAGGCAGG + Intergenic
1049476105 8:142797632-142797654 CAGCAGGGCCCACAGCTGGCTGG + Intergenic
1050027061 9:1346440-1346462 GAGCAGACCAGTAAGCGGGCAGG - Intergenic
1051699183 9:19801361-19801383 GAGCACAGCAGACACCCTGCTGG + Intergenic
1052824994 9:33167713-33167735 GAACGGAGAGGACAGCTGGCGGG + Intergenic
1053134322 9:35640606-35640628 GAGCACAGCAGACACCCTGCCGG + Intronic
1056831428 9:89920290-89920312 GAGAAGAGAAGGCAGCTGGGAGG + Intergenic
1056920692 9:90785829-90785851 GAGCAAAGCTGACATCTGGAGGG + Intergenic
1057440177 9:95077354-95077376 GTGCAGAGAAGACAACTGCCCGG + Intronic
1057568269 9:96184144-96184166 GAAGAGGACAGACAGCTGGCTGG - Intergenic
1058959892 9:109982951-109982973 GACATGGGCAGACAGCTGGCTGG - Intronic
1059740134 9:117142003-117142025 GAGCAGAGAAGACAGCGTCCTGG + Intronic
1060434526 9:123582205-123582227 CAGCACAGAAGGCAGCTGGCGGG - Intronic
1060484949 9:124041017-124041039 GGGCAGAGCAGACATCCTGCGGG + Intergenic
1060667486 9:125440644-125440666 CAGCAGAGCAGAAAGTTGGGAGG - Intronic
1060932950 9:127500434-127500456 GGGCAGAGCAGCCAGCATGCTGG + Intronic
1061710868 9:132486918-132486940 GAACAGAGCAGGCAGCCGGAAGG + Intronic
1061829963 9:133285455-133285477 GAGCAGAGGACAGTGCTGGCTGG + Intergenic
1061831964 9:133301870-133301892 GAGCAGAGGACAGTGCTGGCTGG - Intergenic
1062160371 9:135076322-135076344 CAGCAATGCACACAGCTGGCCGG - Intronic
1062484973 9:136770139-136770161 GAGCAGAGCAGACTGCCCCCTGG - Intergenic
1062626663 9:137446087-137446109 GAGCAGGGCAGGCAGGTCGCTGG + Intergenic
1203631184 Un_KI270750v1:73858-73880 ATGCAGAGCAGACAGAAGGCAGG - Intergenic
1186166032 X:6827029-6827051 GAGCTGAGCATCCAGCTGTCTGG - Intergenic
1186785262 X:12951063-12951085 GAGCAGAGCAGACTGGGGCCTGG + Intergenic
1188878901 X:35468222-35468244 GAACAGAGCAGACAGGAGCCTGG + Intergenic
1189719901 X:43905387-43905409 GAGCAGTGCCCACAGCTGGAAGG + Intergenic
1190728468 X:53208217-53208239 GGGCAGGGCAGACAGAGGGCTGG + Intronic
1192188504 X:68975095-68975117 TACCAGAGCAGAAACCTGGCAGG - Intergenic
1192222689 X:69208053-69208075 GACCAGAGCAGGCAGCTCTCTGG - Intergenic
1192553001 X:72068937-72068959 GGGCAGAGCACAAAGCTGTCAGG - Intergenic
1193172375 X:78350314-78350336 GAGCACAGCAGACACCCTGCTGG + Intergenic
1194074849 X:89377568-89377590 GAGCAGAATAGGCAGATGGCTGG - Intergenic
1195943047 X:110180819-110180841 GAGCAGAGAGGCCTGCTGGCTGG - Intronic
1196893245 X:120310104-120310126 GACCTGAGCAGACTGATGGCAGG + Intronic
1197545315 X:127816545-127816567 GAGCACAGCAGACACCCTGCCGG + Intergenic
1199432085 X:147773226-147773248 GAGCATAGCAGACACCCTGCCGG - Intergenic
1200248824 X:154541508-154541530 GAGCATCGCAGCCAGCTGGGAGG - Intronic
1200730449 Y:6731738-6731760 GAGCAGAATAGGCAGATGGCTGG - Intergenic
1200835379 Y:7726884-7726906 GAGCTGAGCAGGCAGCCGGGAGG + Intergenic
1201767812 Y:17589075-17589097 AAGCAGAGAAGGCAGATGGCGGG + Intergenic
1201833741 Y:18316910-18316932 AAGCAGAGAAGGCAGATGGCGGG - Intergenic
1202132947 Y:21631306-21631328 GAAAAGAGCTAACAGCTGGCCGG + Intergenic