ID: 997613541

View in Genome Browser
Species Human (GRCh38)
Location 5:135231374-135231396
Sequence GTGGAGCTAGAGGCCAGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 489}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997613536_997613541 13 Left 997613536 5:135231338-135231360 CCAGGAAGGTGGAGAGGGAGTGC 0: 1
1: 0
2: 2
3: 42
4: 440
Right 997613541 5:135231374-135231396 GTGGAGCTAGAGGCCAGCGTAGG 0: 1
1: 0
2: 0
3: 21
4: 489
997613532_997613541 26 Left 997613532 5:135231325-135231347 CCAGAGATGTGCTCCAGGAAGGT 0: 1
1: 0
2: 1
3: 15
4: 163
Right 997613541 5:135231374-135231396 GTGGAGCTAGAGGCCAGCGTAGG 0: 1
1: 0
2: 0
3: 21
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997613541 Original CRISPR GTGGAGCTAGAGGCCAGCGT AGG Intronic
900539368 1:3195143-3195165 GCGGAGCCTGAGGCCACCGTGGG + Intronic
900590489 1:3457329-3457351 CCGGACCTAGAGGCCAGGGTAGG + Intronic
900770723 1:4541445-4541467 TAGGAGTTAGAGGCCAGCCTGGG + Intergenic
901054146 1:6440797-6440819 GGGGAGCTAGAGGTCAGCGCGGG + Exonic
901420234 1:9145766-9145788 GAGGAGTTAGAGACCAGCCTGGG + Intergenic
901844074 1:11971168-11971190 GGGGAGGTCGAGGCCAGTGTGGG + Intronic
902480164 1:16707534-16707556 GGGGAGCTAGAGGTCAGCGCGGG - Intergenic
902537305 1:17127163-17127185 CAGGAGTTGGAGGCCAGCGTGGG + Intergenic
902785688 1:18731285-18731307 GGGAAGCCAGAGGCCAGCGAGGG + Intronic
902921531 1:19668640-19668662 TGGGAGCTCGAGGCCAGCCTGGG - Intronic
903606295 1:24577481-24577503 CAGGAGCTGGAGGCCAGCCTGGG - Intronic
903941186 1:26932529-26932551 CTGGAGTTAGAGACCAGCCTGGG - Intronic
904029272 1:27523909-27523931 GTGGAGGTAAAGGGCAGCCTGGG - Intergenic
905364759 1:37444454-37444476 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
906073649 1:43036000-43036022 GGGGACCTAGGGGCCAGGGTGGG - Intergenic
906172033 1:43734516-43734538 CTGGAGTTTGAGGCCAGCCTAGG - Intronic
906213624 1:44026119-44026141 GTTGAGCCACAGGCCAGCCTGGG - Intronic
906530629 1:46521862-46521884 CAGGAGCTAGAGACCAGCTTGGG - Intergenic
906538577 1:46567014-46567036 CTGGAGTTTGAGGCCAGCCTGGG - Intronic
907684754 1:56599678-56599700 GTGGAGTTTGAGACCAGCCTGGG + Intronic
907694224 1:56705606-56705628 CTGGAGCTTGAGACCAGCCTGGG - Intronic
909435112 1:75631873-75631895 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
909815243 1:79984533-79984555 GAGGAGTTTGAGGCCAGCCTAGG - Intergenic
909969008 1:81957488-81957510 CTGGAGTTCGAGGCCAGCCTGGG + Intronic
910220616 1:84886314-84886336 CTGGAGTTGGAGGCCAGCCTGGG + Intronic
910647112 1:89525398-89525420 CTGGAGCGAGACGCCAGCCTGGG - Intronic
910951154 1:92649602-92649624 GTTCAGCTTGAGGCCAGCCTGGG + Intronic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
911623011 1:100088496-100088518 GAGGAGTTTGAGACCAGCGTGGG - Intronic
911992955 1:104725834-104725856 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
912236351 1:107855484-107855506 CAGGAGCTAGAGACCAGCCTGGG - Intronic
912938672 1:114025640-114025662 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
915122037 1:153635358-153635380 CTGGAGCTCGAGACCAGCCTGGG - Intronic
915292862 1:154897934-154897956 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
916054019 1:161055281-161055303 TAGGAGCTTGAGACCAGCGTGGG + Intronic
916095384 1:161345247-161345269 GTGCAGCAAGAGGTCAGGGTGGG - Intronic
916195692 1:162220138-162220160 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
916690817 1:167188305-167188327 TAGGAGCTAGAGACCAGCCTGGG + Intergenic
916701247 1:167297871-167297893 GTAGAGCAAGAGGCCAAGGTGGG + Intronic
917335657 1:173922075-173922097 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
917754891 1:178089185-178089207 CAGGAGCTTGAGGCCAGCCTGGG + Intergenic
918199762 1:182256019-182256041 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
919933655 1:202237277-202237299 GTGCCCCTAGAGGCCAACGTCGG + Intronic
919992290 1:202716657-202716679 GTGGAGCTAGAGTATAGGGTAGG + Intergenic
920241669 1:204556486-204556508 CTGGAGCTCGAGACCAGCCTGGG + Exonic
920975092 1:210778314-210778336 ATGGAGCTTGAGACCAGCCTGGG + Intronic
921018134 1:211211252-211211274 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
921695311 1:218202809-218202831 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
922249144 1:223831172-223831194 CAGGAGCTAGAGGCCAGCCTGGG + Intronic
922767796 1:228165077-228165099 CTGGAGCTTGAGGCCAGCCTGGG + Intergenic
923665707 1:235996784-235996806 CAGGAGCTGGAGGCCAGCCTGGG - Intronic
923700618 1:236296692-236296714 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
924169802 1:241326733-241326755 CTGGAGCTCAAGGCCAGCCTGGG + Intronic
924736089 1:246757434-246757456 GTGGCGCTAGAGGTAAGGGTTGG + Intronic
1062815647 10:498077-498099 GAGGAGTTTGAGGCCAGCCTGGG - Intronic
1063023385 10:2153443-2153465 GGGGAGTTTGAGGCCAGCCTGGG + Intergenic
1063279082 10:4604748-4604770 GAGGAGCTTGAGACCAGCCTAGG + Intergenic
1063608941 10:7546815-7546837 CTGGAGAGGGAGGCCAGCGTGGG + Intergenic
1064191342 10:13208519-13208541 CAGGAGTTTGAGGCCAGCGTGGG + Intronic
1065187991 10:23187870-23187892 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1065204898 10:23347836-23347858 CAGAAGCTAGAGGCCAGCTTGGG + Intergenic
1065784230 10:29198603-29198625 GGGGAGTTTGAGGCCAGCCTGGG + Intergenic
1066077822 10:31897915-31897937 CAGGAGTTTGAGGCCAGCGTGGG + Intronic
1066296813 10:34061056-34061078 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1066758321 10:38731678-38731700 AAGGAGTTAGAGGCCAGTGTGGG + Intergenic
1067107452 10:43375590-43375612 GTGGGGCTGGAGGACAGGGTGGG + Intronic
1067152995 10:43751852-43751874 GTGGAGCCTGCGGCCAGCATTGG + Intergenic
1067568013 10:47351993-47352015 GTGGAGCTCTCGGCCAGCGTGGG - Intronic
1069279000 10:66629915-66629937 GTGGAGGTGGAGGACAGTGTTGG - Intronic
1071301989 10:84262647-84262669 GTGTGGCTAGAGGCCAGGGCAGG - Intergenic
1072258399 10:93642926-93642948 GAGGAGCGAGCGGCCAGTGTAGG - Intronic
1073036921 10:100570261-100570283 GTGGGGCGAGAGGCACGCGTAGG + Intergenic
1074369453 10:112887969-112887991 TAGGAGCTTGAGGCCAGCCTGGG + Intergenic
1074558561 10:114514585-114514607 GAGGAGCTTGAGACCAGCCTGGG - Intronic
1074589278 10:114797430-114797452 GTGGAACTAGTGGGCAGCTTTGG - Intergenic
1074845760 10:117396037-117396059 AAGGAGCTTGAGGCCAGCCTTGG + Intergenic
1074846545 10:117403955-117403977 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1075403121 10:122175161-122175183 CTGGAGTTAGAGACCAGCCTGGG - Intronic
1075759538 10:124845665-124845687 CAGGAGCTAGAGACCAGCCTGGG - Intergenic
1076163302 10:128262620-128262642 CTGGAGCTCGAGACCAGCCTGGG + Intergenic
1076200021 10:128550767-128550789 AGGGAGCTAGAGGGCAGCCTAGG + Intergenic
1076716057 10:132364424-132364446 GTGGAGGTAGATGTAAGCGTGGG - Intronic
1076821071 10:132939897-132939919 GTGGAGAGAGAGGGCAGCGCTGG - Intronic
1077007474 11:365102-365124 GTGGAGGAAGGGGCCAGTGTTGG - Intergenic
1077635276 11:3837927-3837949 CAGGAGCTAGAGGCCAGAGGAGG - Intronic
1078167363 11:8900080-8900102 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1078997349 11:16716333-16716355 TAGGAGCTGGAGGCCAGCTTGGG + Intronic
1079440836 11:20513257-20513279 TTGGAGTTGGAGGCCAGCCTGGG - Intergenic
1080115879 11:28621250-28621272 GAGGAGTTAGAGACCAGCCTGGG - Intergenic
1080321254 11:31012390-31012412 GAGGAGTTAGAGACCAGCCTGGG + Intronic
1083328589 11:61886245-61886267 GTGGAGCCAGAGGTCAGTGGTGG - Intronic
1083351208 11:62030389-62030411 CTGGAGCTGGAGACCAGCCTGGG + Intergenic
1083664037 11:64265149-64265171 GAGGAGCTGGAGGACAGGGTGGG - Intronic
1083957162 11:65990707-65990729 GAGGAGTTTGAGGCCAGCCTGGG - Intergenic
1084055982 11:66633426-66633448 GTGGAGTTCGAGGCCAGCCTGGG - Intronic
1084287745 11:68142755-68142777 GTGCAGCAAGAGTCCAGCCTGGG - Intergenic
1084684872 11:70687617-70687639 GTGGAGGCAGAGGTCAGCTTTGG + Intronic
1085398634 11:76220935-76220957 GAGGAGTTTGAGGCCAGCCTGGG + Intergenic
1087109702 11:94451074-94451096 CTGGAGTTAGAGACCAGCCTGGG + Intronic
1087836168 11:102877439-102877461 CTGGAGTTCGAGGCCAGCCTGGG + Intergenic
1088277457 11:108102537-108102559 GTGGAGTTTGAGACCAGCCTAGG - Intronic
1089254472 11:117187025-117187047 GAGGAGCTGGAGTCCAGAGTAGG + Intronic
1089399865 11:118158116-118158138 GTGGAGCGAGAAGCCAGGGGAGG + Intergenic
1090874880 11:130779999-130780021 GAGGAGAGAGAGGCCAGCCTGGG - Intergenic
1091558041 12:1590644-1590666 GTGGATCCAGCGGCCAGCCTCGG + Intronic
1091953832 12:4619348-4619370 CTGGAGCTTGAGACCAGCCTGGG + Intronic
1091958369 12:4668154-4668176 GTGCAGCTAGAGTCCAGTCTTGG + Intronic
1092066549 12:5594625-5594647 CTGGAGTTAGAGACCAGCCTGGG + Intronic
1092310234 12:7344274-7344296 GAGGAGTTAGAGACCAGCCTGGG - Intergenic
1092717908 12:11410586-11410608 CTGGGGCTAGAAGCCAGGGTGGG - Intronic
1094214188 12:27923078-27923100 GTGGAGCTAGAGCCAAGAGAAGG + Intergenic
1095130842 12:38540617-38540639 ATGGAGCTAGAGTGCAGCTTAGG + Intergenic
1095954020 12:47796322-47796344 GTGCAGTCAGAGGCCAGGGTGGG + Intronic
1096107620 12:49006327-49006349 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
1096274156 12:50191315-50191337 CTGGAGATTGAGGCCAGCCTGGG + Intronic
1096724273 12:53548539-53548561 CAGGAGTTAGAGGCCAGCCTGGG - Intronic
1098269349 12:68754800-68754822 CAGGAGCTTGAGGCCAGCCTGGG - Intronic
1098535665 12:71591487-71591509 CAGGAGCTCGAGACCAGCGTGGG - Intergenic
1098678366 12:73319404-73319426 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1100030360 12:90181028-90181050 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
1100309020 12:93377704-93377726 CTGGCGCTGGAGCCCAGCGTGGG - Intergenic
1100470040 12:94883213-94883235 GAGGAGTTAGAGACCAGCCTAGG + Intergenic
1100989814 12:100239732-100239754 CAGGAGTTAGAGGCCAGCCTGGG - Intronic
1102250242 12:111381717-111381739 TGGGAGCTAGAGACCAGCCTGGG + Intergenic
1102689434 12:114748905-114748927 GAGGAGTTAGAGACCAGCCTGGG + Intergenic
1103266882 12:119638249-119638271 CAGGAGCTGGAGGCCAGCCTGGG + Intronic
1103693335 12:122793661-122793683 CAGGAGCTAGAGACCAGCCTGGG - Intronic
1103705479 12:122868980-122869002 GTGGTGGTGGAGGCCAGCGTAGG - Intronic
1103731010 12:123027834-123027856 GGGGAGCCAGAGGTCAGCTTGGG - Intronic
1103761859 12:123255973-123255995 CTGGAGTTTGAGACCAGCGTGGG - Intronic
1103802434 12:123547831-123547853 CTGGAGCTTGAGACCAGCCTGGG - Intergenic
1104684888 12:130778275-130778297 CAGGAGTTAGAGACCAGCGTGGG + Intergenic
1104693385 12:130844906-130844928 GTGGTGCAAGATGCCAGAGTTGG - Intergenic
1105897219 13:24726500-24726522 CAGGAGCTGGAGGCCAGCCTGGG + Intergenic
1106504200 13:30356862-30356884 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
1108456027 13:50614575-50614597 CCGGAGTTAGAGGCCAGCCTGGG + Intronic
1108604941 13:52028048-52028070 TAGGAGTTAGAGGCCAGCCTGGG + Intronic
1110443944 13:75555799-75555821 CAGGAGCTGGAGGCCAGCCTGGG - Intronic
1110842582 13:80159477-80159499 CAGGAGTTAGAGTCCAGCGTGGG + Intergenic
1112339129 13:98537979-98538001 GTGCAGCTGGAGGTCAGAGTGGG + Intronic
1113176302 13:107568187-107568209 CAGGAGCTAGAGACCAGCCTGGG - Intronic
1115568128 14:34642462-34642484 CGGGAGATAGAGGCCAGCCTAGG + Intergenic
1115685868 14:35795764-35795786 CAGGAGCTTGAGGCCAGCCTGGG + Intronic
1116245245 14:42403268-42403290 CAGGAGATAGAGGCCAGCTTAGG - Intergenic
1116325765 14:43533022-43533044 GTGGAGGGAGAGGCGCGCGTGGG + Intergenic
1116521658 14:45855589-45855611 CTGGAGCTGGAGGACAGCCTGGG - Intergenic
1117269789 14:54131480-54131502 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1117453588 14:55875978-55876000 GTGAAGCTGGATGCCAGGGTAGG + Intergenic
1118836185 14:69479596-69479618 TAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1119009447 14:70969762-70969784 GTGGAGTTCGAGACCAGCCTGGG + Intronic
1119096972 14:71842136-71842158 CAGGAGTTTGAGGCCAGCGTGGG - Intergenic
1119423179 14:74520083-74520105 CTGGAGGAAGAGGCCAGTGTGGG - Intronic
1119510435 14:75207164-75207186 GTGGAGTTTGAGACCAGCCTGGG + Intergenic
1119823680 14:77640026-77640048 CAGGAGCTCGAGACCAGCGTGGG + Intergenic
1123485745 15:20736545-20736567 CAGGAGCTTGAGGCCAGCATAGG + Intergenic
1123542230 15:21305590-21305612 CAGGAGCTTGAGGCCAGCATAGG + Intergenic
1124329435 15:28797152-28797174 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
1124947395 15:34282542-34282564 CAGGAGCTTGAGGCCAGCCTGGG + Intronic
1125658884 15:41380887-41380909 GTGGAGTTTGAGACCAGCCTGGG - Intronic
1125832231 15:42725172-42725194 ATGGAGATAGAGGCCTGCCTGGG - Exonic
1126403683 15:48301002-48301024 GTGTAGGAAGAGGCCAGGGTAGG + Intronic
1126938253 15:53736293-53736315 GTGGAGTCAGAGGCCAGGGATGG + Intronic
1126956916 15:53942869-53942891 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
1127144276 15:56008527-56008549 GAGGAGTTTGAGGCCAGCCTGGG - Intergenic
1127984723 15:64060845-64060867 GTGGAGGGAGAGGCCCGGGTGGG + Intronic
1128241564 15:66104905-66104927 TTGGAGCCAGAAGCCAGAGTTGG + Intronic
1128548038 15:68580329-68580351 GGGGAGCTGGAGGCCAAAGTGGG + Intronic
1129059528 15:72849631-72849653 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1129417613 15:75395688-75395710 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1130911584 15:88274707-88274729 GTGGTGCTAGATGCCAGCCAAGG - Intergenic
1131079543 15:89523226-89523248 GTGGGGACAGAGGCCAGTGTTGG - Intergenic
1131653057 15:94422902-94422924 CTGGAGTTAGAGGCCAGCCTGGG - Intronic
1131969661 15:97878973-97878995 GTGGAGCTGGAGCCCAGTCTGGG + Intergenic
1132379570 15:101357449-101357471 CTGGAGCTAGAGGGCAACCTAGG + Intronic
1202950548 15_KI270727v1_random:32730-32752 CAGGAGCTTGAGGCCAGCATAGG + Intergenic
1132509701 16:332974-332996 CTGGAGCTTGAGACCAGCCTGGG + Intronic
1132709954 16:1262061-1262083 GGGGAGTTTGAGGCCAGCCTGGG - Intergenic
1132848950 16:2015530-2015552 GCGGAGTTAGAGACCAGCCTGGG - Intronic
1133134979 16:3704642-3704664 CAGGAGCTCGAGGCCAGCCTAGG + Intronic
1133508302 16:6433456-6433478 GTGGGGCCAGAGGCCAGCCTAGG + Intronic
1133933615 16:10251931-10251953 CTGGAGTTCGAGGCCAGCCTGGG - Intergenic
1135073262 16:19370921-19370943 CTGGAGCTCGAGACCAGCCTGGG + Intergenic
1135415730 16:22266796-22266818 GGCGAGCTGGAGGCCATCGTGGG + Exonic
1135605151 16:23817720-23817742 TAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1135647098 16:24172635-24172657 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1135988645 16:27203529-27203551 GAGGAGCCAGAGGCTAGCATAGG - Intronic
1136047903 16:27629803-27629825 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1136534750 16:30893131-30893153 CTGGAGGTAGAGGTCAGCGTGGG + Intronic
1137250265 16:46736219-46736241 TAGGAGCTTGAGGCCAGCCTGGG - Intronic
1138381255 16:56604275-56604297 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1138698113 16:58834558-58834580 CTGGAGTTAGAGGCCGGCCTGGG + Intergenic
1139439681 16:66959878-66959900 CAGGAGCTTGAGGCCAGCTTGGG - Intergenic
1139574618 16:67833230-67833252 AAGGAGCTAGAGGACAGCCTGGG - Intronic
1139876641 16:70151276-70151298 CTGGAGTTAGAGTCCAGCCTGGG - Intronic
1140611353 16:76602837-76602859 CAGGAGTTGGAGGCCAGCGTGGG - Intronic
1142524462 17:529817-529839 GTGGAGTTTGAGACCAGCCTGGG + Intronic
1143212402 17:5198416-5198438 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1143311524 17:5995079-5995101 GAGGAGCCGGAGCCCAGCGTGGG + Intronic
1143574596 17:7783612-7783634 GAGGAGTTTGAGACCAGCGTGGG + Intronic
1143611317 17:8019479-8019501 CTTGAGCTTGAGGCCAGCCTGGG - Intronic
1143815712 17:9512660-9512682 TTGGAGTTTGAGGCCAGCCTGGG - Intronic
1143825817 17:9606171-9606193 CTGGAGTTTGAGGCCAGCCTGGG + Intronic
1144039736 17:11399628-11399650 GAGGAGCTCGAGACCAGCATGGG - Intronic
1144314347 17:14045889-14045911 GGGGAGCCAGATGCCGGCGTGGG - Intergenic
1145786633 17:27598013-27598035 GTGGAGCTGGAGGTCAGCTCTGG - Intronic
1145824778 17:27868643-27868665 GTGGGGCTAGATGCCAGTGACGG - Intronic
1145929818 17:28677162-28677184 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1146038708 17:29431230-29431252 CTGGAGTTTGAGGCCAGCCTGGG + Intronic
1147862214 17:43530221-43530243 GTGGAGCTCGAGGGCAGGGGAGG + Intronic
1147962773 17:44177879-44177901 GTGGAGTTAGGGGTCAGCCTGGG - Intronic
1148032313 17:44629697-44629719 TAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1148094336 17:45041908-45041930 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1148452005 17:47784766-47784788 CAGGAGTTAGAGGCCAGCCTTGG - Intergenic
1149566128 17:57641960-57641982 GTAGGGCTGGGGGCCAGCGTCGG + Intronic
1149621047 17:58045312-58045334 GAGGAGTTCGAGGCCAGCCTGGG + Intergenic
1149818756 17:59753173-59753195 GTGGAGGTTGAGGCCAAGGTTGG + Intronic
1149864067 17:60140602-60140624 GAGGAGCTCGAGACCAGCCTGGG + Intergenic
1149946357 17:60931862-60931884 CAGGAGCTAGAGACCAGCCTAGG + Intronic
1150725399 17:67647524-67647546 GAGGAGCTCGAGACCAGCCTGGG - Intronic
1151234250 17:72707189-72707211 CTGGAGTTAGAGACCAGCCTGGG + Intronic
1151676804 17:75602887-75602909 TGGAAGCGAGAGGCCAGCGTGGG - Intergenic
1152125031 17:78441452-78441474 GTGCAGGGAGAGGCCAGCCTTGG + Intronic
1152529591 17:80909575-80909597 GAGGAGTTAGAGACCAGCTTGGG - Intronic
1153719125 18:7883930-7883952 TTGGAGTTAGAGACCAGCCTGGG + Intronic
1154412553 18:14149239-14149261 GTGGAGGTGGAGGCCAGGGAGGG - Intergenic
1155469786 18:26179340-26179362 TAGGAGTTAGAGGCCAGCCTGGG - Intronic
1156333585 18:36148648-36148670 CAGGAGCTTGAGGCCAGCCTGGG + Intronic
1156485292 18:37461817-37461839 ATGGAGGTAGAGGCCAGTGCAGG + Intronic
1156965629 18:43087897-43087919 GTGTAACTAGAGGCAAGCTTTGG - Intronic
1157548317 18:48563406-48563428 GAGGAGCTGCAGGCCAGAGTGGG - Intronic
1157830212 18:50850610-50850632 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1158154904 18:54414662-54414684 CAGGAGTTAGAGGCCAGCCTAGG + Intergenic
1158256599 18:55557362-55557384 CTGGAGCTGGAGTCCAGCCTGGG + Intronic
1158854873 18:61533079-61533101 GAGGAGTTTGAGGCCAGCCTGGG + Intronic
1159254451 18:65928474-65928496 GAGGAGTTTGAGGCCAGCCTGGG - Intergenic
1159470630 18:68850720-68850742 CTGTAGCTAGAGGTAAGCGTGGG - Intronic
1161680514 19:5677670-5677692 GTGGGGCCAGAGGCCTCCGTAGG - Intronic
1161784557 19:6315721-6315743 CTGGAGTTAGAGACCAGCCTGGG - Intronic
1161858474 19:6779650-6779672 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1162108784 19:8388682-8388704 CAGGAGCTAGAGACCAGCCTAGG - Intronic
1162159353 19:8699931-8699953 ATGGAGACAGAGGCCAGCCTTGG + Intergenic
1162206053 19:9056949-9056971 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1162597920 19:11643426-11643448 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1162626939 19:11892186-11892208 CAGGAGCTAGAGACCAGCCTAGG - Intronic
1162677282 19:12308627-12308649 CAGGAGCTAGAGGCCAGCTTGGG + Intergenic
1162678255 19:12317359-12317381 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1163392811 19:17040717-17040739 CTGGAGTTTGAGGCCAGCCTGGG - Intergenic
1163461763 19:17442646-17442668 GTGGAGTTTGAGACCAGCCTGGG - Intronic
1163780248 19:19242924-19242946 GTGGAGTTTGAGACCAGCCTGGG + Intronic
1164680598 19:30131428-30131450 CTGGAGCTCGAGACCAGCCTGGG - Intergenic
1164976849 19:32580181-32580203 CAGGAGATAGAGGCCAGCCTAGG + Intergenic
1165142506 19:33709880-33709902 TAGGAGTTAGAGGCCAGCCTGGG - Intronic
1165872195 19:38980891-38980913 CTGGAGCTACAGGCCAGAGTGGG + Intergenic
1165908713 19:39210511-39210533 CAGGAGCTAGAGACCAGCCTGGG - Intergenic
1165987124 19:39779158-39779180 TAGGAGCTCGAGGCCAGCCTGGG - Intronic
1166393107 19:42421105-42421127 CAGGAGTTTGAGGCCAGCGTGGG - Intronic
1166701884 19:44886830-44886852 TAGGAGCTCGAGACCAGCGTGGG + Intronic
1166786754 19:45371902-45371924 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
1166900193 19:46055298-46055320 CTGAAGTTAGAGGCCAGCCTGGG - Intronic
1167001679 19:46748949-46748971 CAGGAGTTAGAGACCAGCGTGGG - Intronic
1167013059 19:46821695-46821717 GTGGAGCTGGAGGCCTAGGTTGG - Intergenic
1167684639 19:50949141-50949163 GTGGAGATAGAGATCAGGGTTGG - Intronic
1167699953 19:51037187-51037209 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1168263675 19:55209529-55209551 GTGAAGCCAGAGGCCAGGGCGGG + Intergenic
1168327395 19:55545244-55545266 GTGGAGAGAGAGACCAGGGTGGG - Intronic
1168656758 19:58135153-58135175 CTGGAGTTTGAGGCCAGCCTGGG - Intronic
1202714201 1_KI270714v1_random:33440-33462 GGGGAGCTAGGGGTCAGCGCGGG - Intergenic
925171501 2:1752686-1752708 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
928060090 2:28103515-28103537 CTGGAGTTCGAGGCCAGCCTGGG - Intronic
929560341 2:42952684-42952706 GAGGAGCTGGAGGTCAGCTTGGG - Intergenic
929895394 2:45955608-45955630 CTGGAGTTTGAGGCCAGCCTGGG + Intronic
930009819 2:46928098-46928120 GAGGAGTTAGAGACCAGCCTGGG - Intronic
930128535 2:47824277-47824299 CTGGAGCTCGAGACCAGCCTGGG + Intronic
930213630 2:48670182-48670204 TTGGAGTTCGAGGCCAGCTTGGG + Intronic
930663660 2:54080832-54080854 GGGGAGCTTGAGACCAGCCTGGG - Intronic
930703178 2:54479901-54479923 CAGGAGTTAGAGGCCAGCCTGGG - Intronic
931359744 2:61568024-61568046 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
931879321 2:66550704-66550726 CTGGAGTTAGAGACCAGCCTGGG - Intronic
932236663 2:70125820-70125842 AAGGAGCTGGAGACCAGCGTGGG - Intergenic
932243794 2:70179358-70179380 CTGGAGTTCGAGGCCAGCCTGGG + Intronic
932327070 2:70870420-70870442 CTGGAGTTAGAGACCAGCCTGGG - Intergenic
933023935 2:77229644-77229666 GTGGAGCTGGAGAGCAGCGGTGG - Intronic
933442113 2:82326572-82326594 GTGGAGGTAGAGGCGCGGGTGGG - Intergenic
933600169 2:84320783-84320805 CTGGAGTTAGAGACCAGCCTGGG + Intergenic
933736703 2:85501208-85501230 GTGCAGCTAGAGCCCAGAGTGGG + Intergenic
934681416 2:96286528-96286550 GGGGATCTAGAGGCCAGTGAGGG - Intronic
935643044 2:105308720-105308742 CAGGAGCTGGAGGCCAGCCTGGG + Intronic
937206121 2:120238243-120238265 GTGGAGCTTGAGGCTTGAGTGGG - Intergenic
937388100 2:121455649-121455671 TTGGAGGTTGAGGCCAGCCTGGG + Intronic
937394748 2:121524969-121524991 GGGGAGCTAGAGGCCAGGGGAGG + Intronic
938237298 2:129716828-129716850 GTGGAGCTTTAGGCCATCGTGGG - Intergenic
941836182 2:170023179-170023201 CAGGAGTTTGAGGCCAGCGTGGG - Intronic
941928028 2:170915445-170915467 GTGGTGCCAGAGGCCACCATGGG + Intergenic
942013352 2:171787113-171787135 GTGGAGTTCGAGACCAGCCTGGG + Intronic
942099070 2:172560051-172560073 CCGGAGTTTGAGGCCAGCGTAGG - Intronic
942560258 2:177212385-177212407 GGAGAACTAGAGGCCTGCGTGGG + Intergenic
942919182 2:181350355-181350377 GTGGAGCTCAAGACCAGCCTGGG + Intergenic
943628346 2:190223306-190223328 CTGGAGTTTGAGGCCAGCCTGGG - Intronic
943727963 2:191271463-191271485 CTGGAGCTTGAGACCAGCCTGGG + Intronic
944131718 2:196354133-196354155 CTGGAGCCACAGGCCAGAGTGGG + Intronic
944808662 2:203307229-203307251 GTGGAGCTAGAGGACACACTGGG - Intergenic
945765431 2:213970508-213970530 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
945916631 2:215711240-215711262 CAGGAGCTAGAGACCAGCCTGGG - Intergenic
946626962 2:221623315-221623337 CAGGAGTTAGAGGCCAGTGTGGG - Intergenic
948425362 2:237883890-237883912 GTGGACCTACAGGCCAGGGCAGG - Intronic
948476201 2:238221387-238221409 GTGGAGCGGGAGGCCCGGGTTGG + Intergenic
949070991 2:242024039-242024061 GTGGAGCTGGAGACCAGGGGAGG + Intergenic
1169365667 20:4990308-4990330 TGGGAGCTGGAGGCCAGCCTGGG + Intronic
1169494027 20:6096315-6096337 CTGGAGTTAGAGACCAGCCTGGG + Intronic
1171057976 20:21926410-21926432 AAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1171482024 20:25461227-25461249 GAGGAGCCAGAGGCAAGCCTGGG - Intronic
1171943744 20:31356209-31356231 CTGGAGTTGGAGGCCAGCCTGGG + Intergenic
1171965891 20:31530079-31530101 CAGGAGTTAGAGGCCAGTGTGGG + Intronic
1172327339 20:34046709-34046731 GTGTAGATAGAGGCCAGGTTAGG + Intronic
1172455239 20:35066313-35066335 GAGGAGTTAGAGACCAGCCTGGG - Intronic
1173524608 20:43721980-43722002 GTGGAGCTGGAGGCCTGGGTTGG + Intergenic
1174100555 20:48123431-48123453 GTGGAGCTGGAGACCAGGGAGGG - Intergenic
1174149403 20:48475582-48475604 GTGGAGCTGGAGACCTGGGTTGG - Intergenic
1174358507 20:50013980-50014002 GAGGAGTTTGAGGCCAGCCTGGG - Intergenic
1174397386 20:50256061-50256083 GAGGAGTTAGAGACCAGCCTGGG - Intergenic
1174521760 20:51136842-51136864 CTGGAGCTCGAGACCAGCCTGGG + Intergenic
1175475155 20:59267634-59267656 GAGGAGCTCGAGACCAGCCTGGG - Intergenic
1175481563 20:59314773-59314795 CTGGAGCCCGAGGCCAGCATTGG - Intronic
1176860455 21:14009017-14009039 GTGGAGGTGGAGGCCAGGGAGGG + Intergenic
1178956614 21:37028378-37028400 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
1178992115 21:37365921-37365943 GTGGCGCCCGAGACCAGCGTTGG - Intronic
1179109269 21:38432300-38432322 CAGGAGTTAGAGGCCAGCCTGGG - Intronic
1180309897 22:11160077-11160099 AAGGAGTTAGAGGCCAGTGTGGG + Intergenic
1180548374 22:16521887-16521909 AAGGAGTTAGAGGCCAGTGTGGG + Intergenic
1181572332 22:23774323-23774345 CTGGAGCTGGGGGCCAGCTTGGG + Intronic
1182255642 22:29035913-29035935 CAGGAGCTTGAGGCCAGCCTGGG - Intronic
1183929249 22:41226759-41226781 GTGGAGCAAGGGGCCTGCGGTGG + Intronic
1184440376 22:44508735-44508757 CTGGAGTTTGAGGCCAGCCTGGG + Intergenic
1184776858 22:46627617-46627639 GAGGAGCTAGAGGCCATGCTGGG - Intronic
1185242208 22:49752609-49752631 CTGGTGCTAGAGGCCACCGAAGG - Intergenic
949467927 3:4362711-4362733 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
949541861 3:5038798-5038820 CAGGAGCTTGAGGCCAGCCTAGG + Intergenic
949731487 3:7118175-7118197 CAGGAGCTAGAGACCAGCCTGGG + Intronic
949989023 3:9562107-9562129 CTGGAGCTCGAGGCCAGCCTAGG - Intergenic
950627335 3:14257280-14257302 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
950652704 3:14417122-14417144 CAGGAGCTCGAGACCAGCGTGGG + Intronic
951203822 3:19904410-19904432 CAGGAGCTTGAGGCCAGCCTGGG - Intronic
951494298 3:23309185-23309207 CTGGAGTTAGAGACCAGCCTGGG - Intronic
952367989 3:32691845-32691867 CAGGAGTTAGAGACCAGCGTAGG + Intronic
952787562 3:37170863-37170885 CAGGAGTTAGAGACCAGCGTGGG + Intronic
953966651 3:47312751-47312773 TAGGAGTTTGAGGCCAGCGTGGG - Intronic
954357308 3:50092838-50092860 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
954735214 3:52702071-52702093 TAGGAGTTAGAGGCCAGCCTGGG - Intronic
955202067 3:56860389-56860411 CAGGAGCTAGAGACCAGCCTGGG - Intronic
955291842 3:57699249-57699271 GAGGAGTTAGAGACCAGCCTGGG + Intergenic
956102529 3:65783704-65783726 GTGGAGTTTGAGGCCAGCCTGGG - Intronic
956337646 3:68181996-68182018 GGGGAGCTTGAGACCAGCCTGGG + Intronic
956464447 3:69505159-69505181 CTGGAGTTAGAGACCAGCCTGGG + Intronic
956590077 3:70905391-70905413 CAGGAGCTGGAGACCAGCGTGGG + Intergenic
956980613 3:74633158-74633180 CTGGAGATAAAGGCCAGTGTAGG - Intergenic
957692321 3:83588302-83588324 GTGGAGCTTGAGCCCAGGATTGG - Intergenic
958017759 3:87961551-87961573 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
958926917 3:100168483-100168505 CTGGAGCTTGAGACCAGCCTGGG + Intronic
961008882 3:123423234-123423256 GTGGAGCTTGTGCCCAGCTTGGG - Intronic
961494921 3:127284477-127284499 CTGCAGGAAGAGGCCAGCGTGGG - Intergenic
961517514 3:127447162-127447184 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
963151591 3:142051180-142051202 GTAGAGGTAGAGGCCAGGGATGG - Intronic
963919156 3:150889035-150889057 GTTGAGCTAGAAGCCTGCTTAGG - Intronic
964798693 3:160529140-160529162 CAGGAGCTAGAGACCAGCCTGGG - Intronic
965288239 3:166844104-166844126 GTGGAGTTTGAGACCAGCCTGGG + Intergenic
965566233 3:170121263-170121285 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
968094098 3:195915868-195915890 CAGGAGCTAGAGACCAGCTTGGG + Intergenic
968105788 3:196000259-196000281 GTGGAGCTGGAGACCCGGGTTGG - Intergenic
968303981 3:197637434-197637456 GTGGAGCTGGAGACCCGGGTTGG - Intergenic
968329706 3:197856593-197856615 CTGGAGTTAGAGACCAGCCTGGG - Intronic
968549842 4:1216577-1216599 GTGGATCGAAAGGCCAGCGGAGG - Intronic
968662595 4:1804974-1804996 GTGGTGCTGAGGGCCAGCGTTGG + Intronic
968844570 4:3033172-3033194 AAGGAGCTAGAGACCAGCCTGGG + Intronic
970588859 4:17541212-17541234 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
971210790 4:24614196-24614218 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
971288486 4:25312840-25312862 GTGGAGGCAGAGGGCAGCGCAGG + Exonic
971318477 4:25586419-25586441 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
972203749 4:36747408-36747430 ATGGAGCTGGAGGCCTGGGTCGG - Intergenic
972611058 4:40655840-40655862 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
973544106 4:51963033-51963055 CTGGAGTTAGAGACCAGCCTCGG - Intergenic
973771893 4:54214307-54214329 CAGGAGCTAGAGACCAGCTTGGG + Intronic
974145758 4:57945278-57945300 GAGTAGCTGGAGGCCAGGGTAGG + Intergenic
976152371 4:82104989-82105011 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
977278996 4:95015593-95015615 CAGGAGCTAGAGACCAGCCTGGG - Intronic
977811673 4:101362442-101362464 GAGGAGTTTGAGGCCAGCCTAGG + Intergenic
978774140 4:112489105-112489127 GAGGAGTTAGAGGCCAGCCTAGG + Intergenic
979532110 4:121779905-121779927 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
982040111 4:151389123-151389145 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
984561183 4:181272706-181272728 GTAGAAATAGAGGCCAGTGTTGG - Intergenic
985700693 5:1370139-1370161 GTGGCGTTAGAGGCCACCCTAGG + Intergenic
985741200 5:1618438-1618460 GTGGAGCTGGAGACCCGGGTGGG - Intergenic
985741262 5:1618715-1618737 GTGGAGCTGGAGACCTGGGTGGG - Intergenic
985741285 5:1618810-1618832 GTGGAGCTGGAGACCTGGGTGGG - Intergenic
985741395 5:1619358-1619380 GTGGAGCTGGAGACCCGGGTGGG - Intergenic
988065351 5:26224723-26224745 GTGGAGCTGGAGACCTGCGGAGG - Intergenic
989150902 5:38298907-38298929 GTGGAGTTCGAGACCAGCCTGGG - Intronic
990544642 5:56810765-56810787 CTGGAGTTTGAGGCCAGCCTGGG - Intergenic
991061280 5:62379065-62379087 CTGGAGTTAGAGACCAGCCTAGG + Intronic
991154384 5:63414147-63414169 CTGGAGCTAGATGTCAGTGTTGG + Intergenic
991419816 5:66429464-66429486 GTGAGGATAGAGGCCAGCATGGG - Intergenic
992298881 5:75356879-75356901 TAGGAGCTTGAGGCCAGCTTCGG + Intronic
992349003 5:75910352-75910374 GAGGAGCTGAAGGCCATCGTAGG - Intergenic
992401810 5:76418487-76418509 ATGGAGTTTGAGGCCAGCCTGGG + Intronic
992808513 5:80362204-80362226 TAGGAGTTAGAGGCCAGCCTGGG - Intergenic
993573192 5:89568402-89568424 CTGGAGCCTGAGGCCAGCTTGGG - Intergenic
994587693 5:101730811-101730833 CAGGAGCTCGAGGCCAGCCTAGG + Intergenic
995801766 5:116004325-116004347 GTGGAGCTGGACGCCAGCTTAGG + Intronic
996306928 5:122057885-122057907 GAGGAGTTAGAGACCAGCATGGG - Intronic
996403361 5:123086038-123086060 ATGTAGCTGGAGGCCAGGGTAGG - Intergenic
996851404 5:127957257-127957279 CTGGAGCAGGAGGCCAGCATGGG - Intergenic
997439400 5:133898741-133898763 GGGGAGCTTGAGGACAGAGTTGG - Intergenic
997613541 5:135231374-135231396 GTGGAGCTAGAGGCCAGCGTAGG + Intronic
997969795 5:138391847-138391869 GTGGGGCTAGAGGAGAGAGTTGG - Exonic
998100533 5:139429714-139429736 GAAGAGCTTGAGGCCAGCCTGGG + Intronic
999218024 5:149952042-149952064 GTTGAGGTTGAGGCCAGCCTTGG + Intergenic
1000058697 5:157633265-157633287 GTGGAGTTCGAGGCCAGTCTTGG - Intronic
1000241581 5:159413394-159413416 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1001535724 5:172496678-172496700 GAGGAGCTGGACGCCAGTGTAGG + Intergenic
1002285492 5:178160173-178160195 CAGGAGTTTGAGGCCAGCGTGGG - Intergenic
1003540882 6:7017191-7017213 TTGGAGTTCGAGGCCAGCCTAGG - Intergenic
1003890257 6:10557697-10557719 GTGGAGTTGGAGACCAGCCTGGG - Intronic
1004695883 6:18032673-18032695 CTGGAGTTTGAGACCAGCGTGGG + Intergenic
1005726283 6:28651939-28651961 GTAGAGGAAGAGGCCATCGTAGG + Intergenic
1006295231 6:33167279-33167301 CTGGAGCTACAGGCCAGGCTGGG - Exonic
1006383033 6:33711775-33711797 GTGGAGCGGGAGGCCGGAGTGGG + Intergenic
1006776624 6:36597901-36597923 CAGGAGCTTGAGGCCAGCCTGGG - Intronic
1007688759 6:43684063-43684085 AAGGAGTTAGAGGCCAGCCTGGG + Intronic
1008193162 6:48485044-48485066 TGGGAGCTAGAGGCAAGAGTGGG - Intergenic
1008666956 6:53725996-53726018 GTGCCGCTAGAGGGCAGCGCAGG - Intergenic
1011279744 6:85664788-85664810 CTGGAGTTCGAGGCCAGCCTGGG + Intergenic
1013114742 6:107094161-107094183 GAGGAGCTCGAGACCAGCCTGGG + Intronic
1013335382 6:109153452-109153474 CTGGAGTTTGAGGCCAGCCTGGG - Intronic
1014137288 6:117905146-117905168 CAGGAGGTAGAGGCCAGCTTGGG - Intergenic
1014138234 6:117911652-117911674 CTGGAGTTTGAGGCCAGCCTGGG - Intronic
1017009399 6:150053132-150053154 GTGGAGCTGGAGACCAAGGTAGG - Intergenic
1017140253 6:151183678-151183700 TAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1017427641 6:154339481-154339503 CTGGAGTTTGAGGCCAGCTTGGG - Intronic
1018046726 6:159971863-159971885 TAGGAGCTTGAGGCCAGCCTGGG - Intronic
1019289923 7:245424-245446 GTGGAGGCAGGGGCCAGCCTTGG + Intronic
1020065011 7:5181708-5181730 CTGGAGTTAGAGACCAGCCTTGG - Intergenic
1022355016 7:29606541-29606563 ATGGAGGGAGAGGCCAGCCTTGG - Intergenic
1026781649 7:73272013-73272035 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1027022503 7:74825453-74825475 CAGGAGTTAGAGGCCAGCCTGGG - Intronic
1027065514 7:75120469-75120491 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1028150009 7:87361169-87361191 CAGGACCTAGAGGCCAGCCTGGG - Intronic
1029545537 7:101208593-101208615 GGGGAGTTTGAGGCCAGCCTGGG - Intronic
1029662944 7:101975332-101975354 GAGGAGCTTGAGACCAGCCTGGG + Intronic
1029737408 7:102472488-102472510 GTGGAGCTGGAGGCAGACGTGGG + Exonic
1030198802 7:106880882-106880904 AAGGAGTTTGAGGCCAGCGTGGG - Intronic
1030238827 7:107296630-107296652 TAGGAGTTAGAGGCCAGCCTGGG - Intronic
1030988177 7:116266524-116266546 GTGGAGCTTGAGGCAAGTGGAGG + Intergenic
1032584442 7:133133242-133133264 GAGGAGCTAGAGCCCAGGGGTGG - Intergenic
1035196505 7:157225738-157225760 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1035444785 7:158932870-158932892 GTGGAGGCAGAGGCCAACCTAGG - Intronic
1036439564 8:8768536-8768558 CAGGAGTTAGAGACCAGCGTGGG - Intergenic
1036467125 8:9009746-9009768 CTGGAGCTCGAGACCAGCCTGGG - Intronic
1037937247 8:22923356-22923378 CAGGAGTTAGAGGCCAGCCTGGG + Intronic
1038108075 8:24459666-24459688 CTGGAGTTCGAGGCCAGCCTGGG - Intronic
1038488212 8:27951290-27951312 GTGGAGCAGGAGGGCAGTGTGGG + Intronic
1038801400 8:30752523-30752545 CAGGAGCTAGAGACCAGCCTGGG - Intronic
1039070993 8:33649230-33649252 CTGGAGTTTGAGACCAGCGTGGG - Intergenic
1039515690 8:38131433-38131455 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
1039813268 8:41068979-41069001 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
1040905515 8:52465650-52465672 CAGGAGTTGGAGGCCAGCGTGGG + Intergenic
1042252685 8:66772820-66772842 GTGGAGTTTGAGACCAGCCTGGG - Intronic
1042552234 8:70004520-70004542 CTGGAGCTTGAGACCAGCTTAGG - Intergenic
1042593635 8:70422918-70422940 TAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1043668911 8:82856101-82856123 CAGGAGCTTGAGGCCAGCCTTGG + Intergenic
1045357416 8:101402144-101402166 TTGGAGCTGGAGGCCAGTGGGGG - Intergenic
1045999920 8:108407548-108407570 TAGGAGCTTGAGGCCAGCCTGGG - Intronic
1046477394 8:114764056-114764078 GAGGAGCTTGAGACCAGCCTGGG - Intergenic
1049118005 8:140706820-140706842 GAGGAATTAGAGGCCAGCCTGGG + Intronic
1049692223 8:143966481-143966503 GTGGAGGTAGAGAGCAGCCTGGG - Intronic
1050377075 9:4984839-4984861 CTGGAGCTAGGCGCCAGCGCTGG - Intergenic
1051638450 9:19202715-19202737 CAGGAGCTAGAGACCAGCCTAGG + Intergenic
1052929890 9:34047769-34047791 CAGGAGCTGGAGGCCAGCCTGGG + Intronic
1056371980 9:85965417-85965439 GAGGAGTTCGAGGCCAGCCTAGG + Intronic
1056545666 9:87611357-87611379 CAGGAGCTTGAGGCCAGCCTGGG - Intronic
1056930823 9:90875188-90875210 CTGGAGCTTGAGACCAGCCTGGG + Intronic
1057693175 9:97305123-97305145 TAGGAGTTCGAGGCCAGCGTGGG + Intergenic
1057779502 9:98037936-98037958 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1058636142 9:107040501-107040523 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1059787080 9:117597623-117597645 TTGGAGTTAGAGACCAGCCTTGG - Intergenic
1060981169 9:127793123-127793145 GAGGAGCTGGAGACCAGCCTAGG - Intergenic
1061178766 9:129012138-129012160 CAGGAGCTAGAAGCCAGCTTGGG - Intronic
1061415769 9:130446058-130446080 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
1062486283 9:136777991-136778013 GTGGAGCTGGAGACCAGAGAAGG - Intergenic
1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG + Exonic
1062714775 9:138003379-138003401 TTGGAGATAGAGACCAGCCTGGG - Intronic
1185598664 X:1324283-1324305 CAGGAGTTAGAGGCCAGCCTGGG + Intergenic
1186448177 X:9649997-9650019 TAGGAGTTAGAGGCCAGCCTTGG - Intronic
1186651661 X:11567884-11567906 CAGGAGCTCGAGACCAGCGTGGG - Intronic
1186766099 X:12772012-12772034 GAGGAGCTCGAGACCAGCCTGGG - Intergenic
1186907430 X:14126786-14126808 GTAGAGCCAGAAGCCAGGGTAGG - Intergenic
1187391430 X:18888884-18888906 CAGGAGCTAGAGACCAGCCTAGG - Intergenic
1187709641 X:22040420-22040442 CTGGAGTTGGAGGCCAGCCTGGG + Intronic
1187937872 X:24353453-24353475 CTGGAGCTTGAGACCAGCCTGGG + Intergenic
1188951086 X:36376072-36376094 GTGGAGGCAGAGGCCAGCTGTGG + Intronic
1189338073 X:40182863-40182885 CAGGAGCTAGAGACCAGCCTGGG - Intergenic
1190340362 X:49291193-49291215 GAGGAGCTCGAGACCAGCCTGGG - Intronic
1191845788 X:65546904-65546926 TGGGAGCTAGAGACCAGCCTGGG - Intergenic
1195122247 X:101766948-101766970 CAGGAGCTTGAGGCCAGCCTGGG - Intergenic
1196134200 X:112189183-112189205 CAGGAGCTAGAGACCAGCCTGGG + Intergenic
1196378963 X:115068843-115068865 GTAGAGCCAGGGACCAGCGTGGG + Intergenic
1196433695 X:115655088-115655110 CAGGAGTTAGAGACCAGCGTGGG - Intergenic
1198201153 X:134420103-134420125 CTGGAGGTAGAGACCAGCCTGGG + Intronic
1198465098 X:136897883-136897905 CAGGAGTTAGAGGCCAGCCTGGG - Intergenic
1198743297 X:139863851-139863873 TGGGAGCTTGAGACCAGCGTGGG + Intronic
1200951667 Y:8904071-8904093 ATGGAGCTGCAGGCCAGCGTTGG + Intergenic
1201189127 Y:11431244-11431266 AAGGAGTTAGAGGCCAGTGTGGG + Intergenic
1201256037 Y:12109115-12109137 GTGGAGTTTGAGACCAGCCTGGG + Intergenic