ID: 997615025

View in Genome Browser
Species Human (GRCh38)
Location 5:135240314-135240336
Sequence GCTTCCTGGAGGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 1, 2: 15, 3: 107, 4: 676}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997615025 Original CRISPR GCTTCCTGGAGGAGGCTGGG TGG Intronic
900083455 1:875796-875818 GGTTCCTGGAAGCAGCTGGGAGG + Intergenic
900174396 1:1285406-1285428 GCTTCCTGGACTTGGCTGGATGG + Intronic
900325842 1:2108287-2108309 GCTTCCTGGAGGAGGTGAGCAGG - Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900405802 1:2492509-2492531 GCTTCCTGCAGGAGGAGGAGGGG + Intronic
900650872 1:3729590-3729612 GCTTCCTGGAGGAGGAGATGTGG - Intronic
901061117 1:6472353-6472375 GCCTCCTAGAGGAACCTGGGAGG - Intronic
901470572 1:9453340-9453362 GGTTAGTGGAGGAAGCTGGGAGG + Intergenic
901625608 1:10623151-10623173 GCTGCTTGGAGAAGGCTGTGAGG - Intronic
901681104 1:10913305-10913327 GCTTCCTAGAGGAGGAGGTGAGG + Intergenic
901758842 1:11457599-11457621 GCTTCCTGGAGGAGGTGATGCGG - Intergenic
901839037 1:11942501-11942523 GCTTCCTGGAGGAGGTAGACTGG + Intronic
902083059 1:13834379-13834401 GCTGGCTGCAGGATGCTGGGTGG + Intergenic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902753285 1:18532432-18532454 GCTTCCTGGAGAAGATTGAGGGG - Intergenic
903072325 1:20732431-20732453 GCTTCCCGGAGGAGGCGGTGCGG - Exonic
903265768 1:22157098-22157120 GCTTCCTGGAGGAGGGAGGATGG - Intergenic
903676418 1:25067375-25067397 GCTTCCTGGAGGAGGTGGAGCGG - Intergenic
904269527 1:29340619-29340641 GCTTGAGGGTGGAGGCTGGGAGG - Intergenic
904341803 1:29839963-29839985 GGTTCCTGGAGCTGGCTGGTGGG + Intergenic
904411887 1:30329549-30329571 GCAGGCTGGAGGGGGCTGGGGGG + Intergenic
904907325 1:33907452-33907474 GATTTCAGGAGGAGGCTGGAGGG + Intronic
905015365 1:34774571-34774593 GCTTCCTGGAGGAGGGCAGCTGG + Intronic
905316397 1:37084229-37084251 GCGCCCTGGGGGAGGCTGGGGGG + Intergenic
905363850 1:37438219-37438241 GCTTCCTGGAGGAGGTGGCAGGG - Intergenic
905863764 1:41366147-41366169 CCCTGCTGGAGCAGGCTGGGGGG - Intronic
906229863 1:44152873-44152895 TCATCCTGGAGAAGGCAGGGTGG - Intergenic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
906515694 1:46437632-46437654 GCTTCCTGGAGAAGACTGATGGG + Intergenic
906532979 1:46533912-46533934 GCTTCCTGGAGGAGAGGGGTTGG - Intergenic
906707729 1:47906984-47907006 GCTCCCTGGAATAGGCTTGGCGG + Intronic
906951758 1:50340759-50340781 GCTCACTGGAAGGGGCTGGGTGG - Intergenic
907357693 1:53889822-53889844 TCTTCCCGGAGGAGGCGGAGAGG - Intronic
907394454 1:54179488-54179510 GCTTTCTGGAGGAGGTAGAGAGG - Intronic
907481763 1:54749823-54749845 GCTTCCTGAAGGAGGCAGTTGGG - Intergenic
907520758 1:55021985-55022007 GCTTCCTGGAGGTGGCAGCTCGG - Intergenic
908472637 1:64459099-64459121 GCATGCTGGAGGAGGGTGTGGGG + Intergenic
908791500 1:67787222-67787244 GCTTCCAGGAGGAAGCAGTGTGG + Intronic
909657268 1:78045888-78045910 CCATCCCGGGGGAGGCTGGGCGG + Exonic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
910155186 1:84209373-84209395 GCTTCGTGGAGGGGGGTGGGTGG - Intronic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
910670959 1:89772308-89772330 GCCTCCTGGAGGACGCTGTGAGG + Intronic
911011852 1:93288847-93288869 GCTTGCTGCAGGGGGTTGGGGGG + Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
911260187 1:95676835-95676857 GCTTGTGGGAGGAGGTTGGGAGG + Intergenic
912392968 1:109317567-109317589 CCTTCCTGGGGGTGGTTGGGCGG + Intronic
912420442 1:109539106-109539128 GCTTCCTGAAGGAGACAGAGTGG - Intergenic
914347699 1:146814128-146814150 GCTTGCGGGTGGAGGGTGGGAGG + Intergenic
915305646 1:154975921-154975943 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
915431093 1:155867743-155867765 GCTTTCTATAGAAGGCTGGGAGG + Intronic
915576769 1:156784337-156784359 GCTTCCTGGAGGAGGTAGACTGG + Intronic
916585638 1:166147471-166147493 TCTGCCTGGAGAAGGCTGGATGG + Intronic
917471896 1:175332772-175332794 GCTTCCTGGAGAAGGCATTGAGG - Intronic
917644187 1:177013807-177013829 GGGTCCTGAAGGAGGGTGGGAGG - Intronic
917852181 1:179074360-179074382 GCTTCCAGGAGCCAGCTGGGAGG + Exonic
919939704 1:202277843-202277865 GCTTCCTGGGGGAGGTGGGGTGG + Intronic
920211507 1:204332017-204332039 TCTTCCTGGAGCAGGCTGCCAGG - Intronic
920307965 1:205031100-205031122 GCGCCCTGGAGGAGGGCGGGGGG - Intergenic
922044416 1:221929297-221929319 GCTGCCTGGAGCTGGCAGGGAGG - Intergenic
922135198 1:222818338-222818360 GTTACCTGGAGAGGGCTGGGAGG + Intergenic
922327585 1:224543210-224543232 GCTTCCTGGTTGGTGCTGGGAGG + Intronic
922776643 1:228217163-228217185 GCTTCTTGCAGGAGGATGTGGGG + Exonic
922790421 1:228308027-228308049 GCTTCCTGGAGGAGGGGGCGTGG + Intronic
923624075 1:235599965-235599987 ACTTCCTGGGGTAGGCTGGTGGG - Intronic
923663798 1:235981068-235981090 CCTTCAAGGAGGAGGCTGAGTGG + Intronic
924038350 1:239958214-239958236 CATTGCTGGAGGAGGCTGTGTGG - Intergenic
1063155985 10:3379543-3379565 GCCTCCGGGAAGAGGCTTGGTGG - Intergenic
1063266591 10:4458226-4458248 GCTTACGGGTGGAGGGTGGGAGG - Intergenic
1063434612 10:6020000-6020022 GCTGCCTGGGGCAGGCGGGGTGG - Intronic
1063526842 10:6795100-6795122 GCTTGATGGGGGAGGGTGGGAGG + Intergenic
1063960041 10:11299454-11299476 CCTTCCTGGGGGGGGTTGGGGGG - Intronic
1065176330 10:23079763-23079785 GCTTCCTGAAGGAGGCAGTGGGG + Intergenic
1066649293 10:37639915-37639937 GCTTCCTGGAGGAGGCAGCTGGG - Intergenic
1067032151 10:42885317-42885339 GCTTCCTGGAGGAGGCAGCTGGG - Intergenic
1067508416 10:46875881-46875903 GCTTCCTGGAGGAGGAAAGATGG + Intergenic
1067653833 10:48175968-48175990 GCTTCCTGGAGGAGGAAAGATGG - Intronic
1069628521 10:69882877-69882899 GCTTCCTGGAAGGAGCTGAGGGG - Intronic
1069786742 10:70993096-70993118 GCTTCCTGGAGGAGGTGCTGAGG - Intergenic
1069997998 10:72354790-72354812 GCTTCCTGGAGAAGGCACAGCGG - Exonic
1070345270 10:75535834-75535856 GCTTCTGGGAGGAGGCAGTGTGG + Intronic
1070508513 10:77138572-77138594 GCTTTCTGGAGAATGCTGGTGGG - Intronic
1070564246 10:77591363-77591385 GCTTCCTGGAGGAGGTGGTCAGG - Intronic
1070702862 10:78616151-78616173 GCTTCCTAGAGGAGGGGGTGTGG - Intergenic
1070707804 10:78654086-78654108 GCTTCCTTGAGGAGGCATGAGGG + Intergenic
1070780782 10:79136313-79136335 ACTTCCTGGGACAGGCTGGGGGG - Intronic
1070790578 10:79186965-79186987 GCTTCCTGGAGGAGGAGAGGTGG - Intronic
1070814658 10:79315154-79315176 GCTTGCTGGTGGAGGCTTGCTGG - Exonic
1070828222 10:79403550-79403572 GCGGCCTGCAGGATGCTGGGAGG + Intronic
1071542499 10:86499761-86499783 GCTTTCTGGGGGAGGCTGCAAGG + Exonic
1072632279 10:97154648-97154670 GCTTTCGGGAGGGGGCTGGTTGG - Intronic
1072782160 10:98258377-98258399 GCATCCTTGATGAGGCTGTGGGG - Intronic
1072817068 10:98519827-98519849 CTTTCCTGGAGGGGTCTGGGTGG - Intronic
1073011936 10:100366991-100367013 GATTCCTGGAGGAAGCATGGAGG - Intergenic
1073056932 10:100709258-100709280 GCTTCCCGGAGGAACCTGGTGGG + Intergenic
1073073703 10:100810311-100810333 GCCCCCAGGTGGAGGCTGGGTGG - Intronic
1073375136 10:103027417-103027439 GCTTACTGGATGAGGCAGTGGGG - Intronic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1074543482 10:114385077-114385099 GCTTCCAGGAGGAGGCAGGGGGG + Intronic
1074656188 10:115590629-115590651 TCTTCCTGGAGGAGGCAGGTGGG - Intronic
1074892733 10:117748940-117748962 GCCTCCTGGTGGAGGCCAGGTGG + Intergenic
1075141927 10:119845548-119845570 GGTTCCCTAAGGAGGCTGGGTGG + Intronic
1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG + Intergenic
1075686241 10:124367171-124367193 GGTGTCTGGGGGAGGCTGGGTGG - Intergenic
1075989420 10:126822400-126822422 ATTTCCTGGAGGAGGCTAGTAGG - Intergenic
1076463282 10:130660851-130660873 GCTTCCTGCAGGAGGCCTGTGGG + Intergenic
1076674801 10:132142295-132142317 GGGTCCTGGGGGAGGCGGGGTGG + Intronic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076915137 10:133419654-133419676 CATCCCTGGAGGAGGCAGGGAGG + Intronic
1077050275 11:563326-563348 GGTTCTGGGGGGAGGCTGGGAGG + Intronic
1077097642 11:805661-805683 GCTTCCCGGAGGAGGCCGTTTGG - Intronic
1077107710 11:849207-849229 GCTGCCTGGTGGAGGGGGGGTGG + Intronic
1077217763 11:1402155-1402177 GCAGCCTGGGGAAGGCTGGGGGG + Intronic
1077225355 11:1437028-1437050 GCTGCCTGGATGGGGCTGGCAGG + Intronic
1077233267 11:1468178-1468200 GCTGCCGAGCGGAGGCTGGGTGG - Intergenic
1077297963 11:1834850-1834872 GCTGCTGGGAGGTGGCTGGGAGG + Intronic
1077366831 11:2164641-2164663 GCTTCCTGGAGGAGGCCCAGTGG - Intronic
1077407397 11:2388778-2388800 GCTTCCTGGAGGAGGAGGCAGGG - Intronic
1078234458 11:9471353-9471375 GTTTCCTGGAGGAGGGATGGAGG + Exonic
1079026386 11:16951244-16951266 GCTGCATGGAGGAGGCTGAAGGG - Intronic
1079392008 11:20030085-20030107 GTTTCCAGGAGGAGGCCGTGGGG + Intronic
1079392677 11:20036113-20036135 GGCTGCTGGAGGAGCCTGGGAGG - Intronic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1081626657 11:44659987-44660009 GCTTCTCAGAAGAGGCTGGGAGG - Intergenic
1082790401 11:57342877-57342899 GCTCCCTGGGGGCGGATGGGAGG + Intronic
1082869115 11:57927670-57927692 ACTTGATGGAGGAGGTTGGGAGG - Intergenic
1083333064 11:61908028-61908050 GGTGCCTGCAGTAGGCTGGGGGG - Intronic
1083771073 11:64867924-64867946 GTGGCCTGGAGGAGGCTGGGTGG - Intronic
1083856338 11:65394814-65394836 GGCTCCTGGAGAGGGCTGGGAGG - Intronic
1083883249 11:65558498-65558520 GCAGGCTGGCGGAGGCTGGGGGG + Intronic
1083945436 11:65920325-65920347 GCTTCCTGGAAGAGGTGAGGAGG - Exonic
1084274480 11:68044463-68044485 GGGCCATGGAGGAGGCTGGGAGG - Intronic
1084400840 11:68942063-68942085 GCTCCATGCAGGAGGCTGGGGGG - Intergenic
1085082664 11:73647172-73647194 GCTTCCCAGAGGAGGCTGAAAGG - Intronic
1085301667 11:75462438-75462460 GCTTCCTGGAGGAGGAGGCATGG - Intronic
1085429209 11:76432412-76432434 GCTTCGGGGAGAAGGGTGGGAGG + Intergenic
1085798362 11:79564495-79564517 GGTTCCTGGAGGACTCTTGGTGG - Intergenic
1086297927 11:85392037-85392059 GCTTCCTGGAGGAGTCTTTAGGG - Intronic
1086535416 11:87838578-87838600 GCTCTCTGGAGAAAGCTGGGTGG + Intergenic
1088157264 11:106822511-106822533 GCTTGAGGGAGGAGGCTGAGAGG - Intronic
1089121648 11:116139873-116139895 GCTTCATGGAGGAGGGAGGGAGG - Intergenic
1090082963 11:123626627-123626649 TCCTCCTGGAGGAGGCAGGCAGG - Intronic
1090894662 11:130960532-130960554 GCTTTCTGGAGGAGTCTTTGGGG + Intergenic
1091207846 11:133833336-133833358 GCTGCCGGGCGGAGGCGGGGTGG + Intergenic
1091402573 12:189705-189727 GCTTCCTGGAGGAGGAGGCAGGG - Intergenic
1091784841 12:3237071-3237093 GCCTCCTGGAGTAGGTGGGGCGG + Intronic
1092821531 12:12357523-12357545 GCGGGCTGGAGGAGGGTGGGAGG - Intronic
1092974888 12:13735355-13735377 GCTTCCTGGAAGATGCTTGTTGG + Intronic
1094492628 12:30970534-30970556 GCATGCTGGAAGAGGCAGGGAGG - Intronic
1095244818 12:39907684-39907706 GCTTTCTGCAGGAGGATGGTTGG - Intronic
1095882833 12:47156645-47156667 GCTTCCTGGAGGAGGTGGTATGG - Intronic
1096478086 12:51920915-51920937 TCTGCCTGCAGGGGGCTGGGGGG + Exonic
1096513203 12:52143270-52143292 GCTTCCTGGTGGAGGCCAGCAGG - Intergenic
1096517584 12:52165637-52165659 GCTTCCTGGAGGAGGGGAGGAGG - Intergenic
1096521973 12:52189607-52189629 GCCTCCTTGTGGAGGCTGTGAGG - Intronic
1096529217 12:52232949-52232971 GCTTCCCGGAGGAGGATGCTTGG - Intronic
1096648369 12:53050102-53050124 GCTTCCTGGAAGCGGCCTGGCGG - Intronic
1096670220 12:53194048-53194070 CCTTCCTGGAGCAGTCTGAGTGG - Exonic
1097198009 12:57254967-57254989 GCTGCCTGGAGGGGGTGGGGGGG - Exonic
1097954939 12:65474664-65474686 GCTTCATTGTGGCGGCTGGGAGG - Intronic
1099369272 12:81810622-81810644 TTTTCCTGGAGTAGGTTGGGAGG + Intergenic
1099884429 12:88509577-88509599 TCTTCCTGCAGGAGACAGGGAGG + Intronic
1100575848 12:95890878-95890900 GCATCCTTGAGGAGTCCGGGAGG - Exonic
1100904845 12:99286098-99286120 GCTGCCTGGAGTTGGCTGAGGGG - Intronic
1101726578 12:107393135-107393157 GCTTCCTTGAGGGGCCTTGGGGG + Intronic
1101898061 12:108770407-108770429 GCCTCCTGATGGAGGCTGGAAGG - Intergenic
1102012481 12:109627165-109627187 GCTTCCAGGAGGAGGCAGACAGG + Intergenic
1102042255 12:109808464-109808486 GCTTCCTGGAGGAGGTAGGGAGG + Exonic
1102059245 12:109920398-109920420 GCTTACAGTAGGAGGCTGGCGGG + Intronic
1102477125 12:113195934-113195956 GCCTCAGGGAGGAGGGTGGGAGG - Intronic
1102492170 12:113296027-113296049 GCTGCCTGGGGGCTGCTGGGCGG - Exonic
1102987949 12:117293968-117293990 TCTTCCAGGAGGAGTCTTGGAGG + Intronic
1103726032 12:122997772-122997794 GCCTGCAGGAGGAGGCAGGGAGG + Intronic
1103763175 12:123265718-123265740 GCTTCCTGGAGACGACTGGGTGG - Intronic
1103972967 12:124683543-124683565 GCTGCCTGGCGGAGGCTGGAAGG - Intergenic
1104719952 12:131039697-131039719 ACTCCCTGGAGGAGGGTGGCTGG + Intronic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1104928851 12:132327984-132328006 GCTTTCTGGAGGAGGTTTGCTGG + Intronic
1104963747 12:132499951-132499973 GCGTCAGGGAGGAGGCTGGGTGG + Intronic
1105702622 13:22944437-22944459 GCTGGCTGGAGGGGGCTTGGCGG - Intergenic
1105855252 13:24366231-24366253 GCTGGCTGGAGGGGGCTTGGTGG - Intergenic
1105931148 13:25053597-25053619 GCTTTCTGGAGGAGTCTTTGGGG - Intergenic
1106104371 13:26721454-26721476 GCTCCCTGGATGGGGCTCGGGGG + Intergenic
1106182421 13:27380913-27380935 GCTTCCTCTAGGAGGCTAGATGG - Intergenic
1108585065 13:51863847-51863869 GCTTTCTGGAGGAAGCTGCCAGG - Intronic
1109630025 13:65033580-65033602 GCTTCCTGGAGGTGGCAAGATGG - Intergenic
1109726592 13:66349190-66349212 GTTTCCTGGAGGAGGGAGGATGG + Intronic
1110862624 13:80359631-80359653 GCTTACAGAAGGAGGCTGGGAGG + Intergenic
1112423655 13:99276644-99276666 ACTTCCTGGAGGCTGGTGGGTGG + Intronic
1113047362 13:106170289-106170311 GCTTTCTGGAGGGAACTGGGAGG - Intergenic
1113637804 13:111932716-111932738 GCTTTCTGGAGGAGGCTTTAGGG + Intergenic
1114259680 14:21027158-21027180 TCTGCCTGCAGCAGGCTGGGTGG - Intronic
1114648725 14:24269957-24269979 GTTTCCTGGAGGTGGATGAGCGG - Exonic
1114826622 14:26088543-26088565 GCTTACTGGGGGGGGCAGGGTGG - Intergenic
1115130088 14:30044478-30044500 GCTTTCTGGAGGAGTCTTGAGGG - Intronic
1115167769 14:30468723-30468745 GCTGCCTGGAGCCGGGTGGGGGG + Intergenic
1118318108 14:64737795-64737817 GCTGCCTGCAGGAGGACGGGAGG + Intronic
1118779136 14:68994650-68994672 GCTTGCTGGCTGAGGCTGGAAGG - Intergenic
1118845105 14:69542040-69542062 GCTTGCAGGGGGAGTCTGGGAGG + Intergenic
1119258244 14:73218607-73218629 GCTTCACGGAGGAGCCTGTGCGG + Intronic
1119319002 14:73718467-73718489 GCTTCCTGGAGGCCGAGGGGAGG + Exonic
1119481548 14:74961278-74961300 GGGTCCTGGAAGAGCCTGGGAGG - Intergenic
1119648010 14:76362495-76362517 GCTACCAGGATGAGGCTGGCAGG - Intronic
1120045422 14:79800274-79800296 GTTTCCTGGAGGAGCGTGGATGG + Intronic
1121013767 14:90536168-90536190 GCTTCCTGGAGGAGGTGGGTGGG - Exonic
1121017530 14:90557573-90557595 GCTTCCTGGAGGAGGGTCCTTGG + Intronic
1121454092 14:94027350-94027372 GCATCCTGCAGGGGACTGGGTGG + Intronic
1121957083 14:98223942-98223964 ACTTCCTGGAGAAGGAAGGGAGG + Intergenic
1122138416 14:99647657-99647679 GCCTCCTGGAGCATGCTGGCGGG + Intronic
1122205829 14:100147534-100147556 ACTTCCTGGAGGAAGTTGGTGGG - Intronic
1122346946 14:101066643-101066665 CCATCCTGGAGGCGGGTGGGTGG + Intergenic
1122349389 14:101078636-101078658 GCTTCCTGGAGGAAGGGGGCTGG - Intergenic
1122488641 14:102098056-102098078 TCTCCCTGGAGGTGGCAGGGAGG - Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122842076 14:104470870-104470892 GCTGCCTGGAGGAGGCGGCCTGG - Intergenic
1122847795 14:104510290-104510312 GCCTCCTGGATGGGGGTGGGAGG - Intronic
1122960069 14:105090206-105090228 GCATCCTGGAGAGGGCGGGGAGG + Intergenic
1123008975 14:105338122-105338144 GTTTCCTGGAGGAGGAAGCGGGG + Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1123755483 15:23394667-23394689 TCTTCCTGCAGGAGGAAGGGTGG + Intergenic
1124115487 15:26838989-26839011 GTTTTCTGAAGGAGGCTGGAGGG - Intronic
1124182676 15:27491362-27491384 GCTGCCTGTCTGAGGCTGGGAGG - Intronic
1124218541 15:27829592-27829614 GTTTCCAGGAGTAGGATGGGAGG + Intronic
1125394033 15:39227287-39227309 CCTTCATGGAGGATGGTGGGTGG + Intergenic
1125403577 15:39330005-39330027 GCTGCAAGGAGAAGGCTGGGGGG + Intergenic
1126206920 15:46056498-46056520 GCTTTCTGAAGGAAGCAGGGAGG - Intergenic
1126223763 15:46245482-46245504 GCTTGATGGGGGAGGGTGGGAGG - Intergenic
1128089845 15:64911970-64911992 TCTGCCTGGAGGAGGGAGGGGGG + Intronic
1128109676 15:65068338-65068360 GCTTCCTGGAGGAGGAGGCGGGG - Intronic
1128363662 15:66981750-66981772 GCATCTGGGAGGAGGCTGGCTGG + Intergenic
1128454346 15:67824142-67824164 CCCTCCTGGAGGTGGCTGGAGGG - Intronic
1128454439 15:67824706-67824728 GCTTTCTGGCTGAGGCAGGGAGG - Exonic
1129717472 15:77860567-77860589 GCTCACTGGAGCATGCTGGGTGG - Intergenic
1129879207 15:78996020-78996042 GCTTCCTGCATCTGGCTGGGTGG + Intronic
1129940847 15:79495421-79495443 GCTCCCTGGAGGGAGCGGGGTGG + Intergenic
1130879447 15:88042577-88042599 GGTTCCTGTAAGAGGCTGGGAGG - Intronic
1131075065 15:89490293-89490315 GCTACCTGGAGGAGGCTTAGGGG + Intronic
1131083191 15:89554239-89554261 GCTCCCATGAGGAGACTGGGCGG + Intergenic
1131133216 15:89913043-89913065 GCTTCCGGGAGGACCCTGGCTGG + Intergenic
1131150089 15:90042348-90042370 GCTGCCTGGAGGGGGTGGGGGGG - Intronic
1131261977 15:90892249-90892271 GTTTCCTGGAGGATGGTGTGTGG - Intronic
1132621831 16:871409-871431 TCTTCCTGGAGCAGGGAGGGGGG + Intronic
1132776257 16:1596204-1596226 GCTCCAGGGAGGAGGCTGGGAGG - Intronic
1132810729 16:1795382-1795404 GGCTCATGGAGGAGCCTGGGAGG - Intergenic
1132893738 16:2217581-2217603 AGGTCCTGGCGGAGGCTGGGAGG + Intergenic
1132989181 16:2784431-2784453 GATTCCTGGATGAGGGTTGGTGG + Exonic
1134044279 16:11089819-11089841 GGTGCCTGGCGGTGGCTGGGTGG - Intronic
1134812460 16:17179227-17179249 GTCTCCTTGAGGAGGCAGGGAGG + Intronic
1134904708 16:17970393-17970415 GCTGCCTGGCGCATGCTGGGGGG - Intergenic
1135287793 16:21209171-21209193 ACTGTCTGGAGGAGGGTGGGGGG - Intronic
1136267432 16:29129927-29129949 GCGGCTTGGAGGAGGCTGAGTGG + Intergenic
1137436140 16:48455593-48455615 GCTTCCTGGAGGAGGACTGGGGG + Intergenic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1137670258 16:50274442-50274464 GGTTGGTGGGGGAGGCTGGGTGG + Intronic
1139434103 16:66926273-66926295 GCTGCCTGGTGGGTGCTGGGAGG - Intergenic
1139986340 16:70901410-70901432 GCTTGCGGGTGGAGGGTGGGAGG - Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141556002 16:84837090-84837112 GCTTGATGGAGGTGACTGGGTGG + Intronic
1141605627 16:85151881-85151903 GATTGCTGAGGGAGGCTGGGAGG - Intergenic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1142070724 16:88090250-88090272 GCGGCTTGGAGGAGGCTGAGTGG + Intronic
1142105238 16:88299090-88299112 GCTTCCTGGAGGAGGCAGCTTGG + Intergenic
1142105250 16:88299123-88299145 GCTTCCTGGAGGAGGCAGCTTGG + Intergenic
1142105262 16:88299156-88299178 GCTTCCTGGAGGAGGCAGCTTGG + Intergenic
1142105273 16:88299188-88299210 GCTTCCTGGAGGAGGCAGCTTGG + Intergenic
1142118105 16:88370941-88370963 GCTACCTGCTGGAGGATGGGAGG + Intergenic
1142172647 16:88630897-88630919 GCTTTGTGGAGCAGACTGGGAGG - Intronic
1142351481 16:89582784-89582806 ACTGCCTGGCGGATGCTGGGAGG - Intronic
1142375790 16:89706577-89706599 GCTACCAGGAGCTGGCTGGGGGG - Intergenic
1142407706 16:89900341-89900363 GCTTCAGAGAGGAGCCTGGGCGG + Intronic
1142667988 17:1473376-1473398 GCTTGCTGGAGAGGCCTGGGCGG + Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143001776 17:3799182-3799204 GTTTCCTGGAGGAGGTGAGGTGG - Intronic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1143014838 17:3886209-3886231 GCTCCCTGGAGGAGGCGGGTGGG - Intronic
1143184078 17:5000140-5000162 GGTTCCGGGAAGAAGCTGGGAGG + Intronic
1143503926 17:7353526-7353548 GCTTCCTGGAGGAGGTGCTGCGG + Exonic
1143765619 17:9135713-9135735 GCTCCCTGGAGTAGGCCTGGTGG + Intronic
1144674367 17:17152525-17152547 GCTTCCTGGGGGAGGCTTCCTGG + Intronic
1145273045 17:21414773-21414795 GTCCGCTGGAGGAGGCTGGGAGG + Intronic
1145311243 17:21702217-21702239 GTCCGCTGGAGGAGGCTGGGAGG + Intronic
1146346606 17:32064242-32064264 GTTTCCTGGAGGGGGGTGGAGGG - Intergenic
1146463603 17:33067329-33067351 GCTTCCTGGAGGAGGTGGCATGG + Intronic
1146653659 17:34622610-34622632 GCATCCAAGAGGAGACTGGGTGG - Intronic
1146937966 17:36824277-36824299 GTGTCCTGGAGGAGGCTGTGGGG - Intergenic
1147160194 17:38565029-38565051 GGCTCCTGGGGGAGGCTGGCTGG - Intronic
1147326528 17:39672357-39672379 GTGTCCTGGAGGAGGGTGGGGGG + Exonic
1147335708 17:39725875-39725897 GCTGCCTGGAGGAGGGTGGGAGG + Intronic
1147600462 17:41742086-41742108 GCTTCCTGGAGGAGGGTTTGGGG - Intergenic
1148071846 17:44913229-44913251 GCTGCCTGGAGGAGGCAGGCTGG + Intronic
1148109676 17:45137415-45137437 GGTTCCTTGGGGAGGCAGGGAGG - Exonic
1148208190 17:45792633-45792655 GCTTCCTGGAGGAGGAGGTGGGG - Intronic
1148209557 17:45800006-45800028 GCTTCCTGGAGGAGGTGAGCTGG - Intronic
1148579350 17:48733101-48733123 CCTTCCTGGAGGTGTCTGGCGGG - Intergenic
1148679585 17:49466044-49466066 GCTTCCTGGAGGAGGAGGAAAGG - Intronic
1149611691 17:57962219-57962241 GCTCCCTAGAGGAGGTTGTGGGG + Intergenic
1149624595 17:58071590-58071612 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
1150123443 17:62621645-62621667 GCTTCCTGGAAGACACTGTGAGG + Intergenic
1150303959 17:64068693-64068715 GCTGGCAGGTGGAGGCTGGGAGG + Intronic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1151155868 17:72122745-72122767 CCTTCGTGGAGGAGGCGGAGCGG + Exonic
1151385623 17:73753596-73753618 GCTACCTAGATGAGGCTGGGTGG + Intergenic
1151579313 17:74969159-74969181 GCTTCCTTGGGCGGGCTGGGTGG - Intronic
1151763426 17:76120339-76120361 GGTTCCAGGAGAAGGCTGTGGGG + Intronic
1151785105 17:76271612-76271634 GCTTCCTGGGAGGGCCTGGGGGG - Intergenic
1152109468 17:78349709-78349731 GCTTCAGGGAGGAGGCAGGAAGG + Intergenic
1152129344 17:78466661-78466683 GCTTCCTGGAGGAGACTGAGGGG - Exonic
1152160402 17:78664973-78664995 GTTTCCAGGAGGTGGCTGGTGGG + Intergenic
1152597273 17:81243867-81243889 GGGGCCGGGAGGAGGCTGGGAGG - Intergenic
1152654872 17:81514811-81514833 GCTTCCCGGCGGAGGCGGGCGGG - Intronic
1152658131 17:81529407-81529429 GCTTCAGGGAGGAGGCCGTGGGG + Intronic
1152717590 17:81907379-81907401 GCTCACTGGTGGATGCTGGGAGG - Intronic
1152784211 17:82239624-82239646 GCTGCATGGAGGGGGCTGCGGGG + Exonic
1152822061 17:82442405-82442427 GGCTCCTGCTGGAGGCTGGGGGG + Exonic
1153329993 18:3863793-3863815 GCTTCCTAGAGGGGCCTGGGAGG - Intronic
1154313540 18:13285539-13285561 GCTTCCTGCAGGAGGCTTCGTGG + Intronic
1154333394 18:13447962-13447984 GCTTCCTGGGGGAGGCCAAGGGG + Intronic
1156451765 18:37270602-37270624 GCTCCCTGAAGGAAGATGGGAGG + Intronic
1156453627 18:37280594-37280616 GCTTCCAGGAGGAGGTGGGCTGG + Intronic
1157212956 18:45759616-45759638 GCTTCCTGGAGGAGGTGTGAAGG + Intergenic
1157297400 18:46456368-46456390 GCTTCCTGGCGGAGGCTTCATGG + Intronic
1157404452 18:47411324-47411346 GCTTCCTGGAGGAGGTGAAGTGG + Intergenic
1157498383 18:48172336-48172358 GCTTGGTGGAGCAGGCAGGGGGG + Intronic
1157600286 18:48889377-48889399 GAGTCCTGGAGGGGGTTGGGAGG + Intergenic
1157946798 18:51989483-51989505 GCTTCCAGGAGGAGCCTGGGAGG + Intergenic
1159116125 18:64114983-64115005 CCTGCATGGAGGAGGGTGGGAGG - Intergenic
1160464935 18:79068926-79068948 GCTTCCAGGAGACGGCTGCGAGG + Intergenic
1160512304 18:79459370-79459392 GCCACCTGGAGGAGGCCGCGGGG + Intronic
1160686168 19:437858-437880 ACTTCCTGGAGGGCTCTGGGAGG - Intronic
1160790079 19:919090-919112 GCTTGCGGGAAGGGGCTGGGCGG + Intronic
1160798556 19:956742-956764 CCTTCCGGGAAGGGGCTGGGGGG - Intronic
1160838465 19:1135774-1135796 TCCTCCTGGAGGGGGCTGGGGGG + Intronic
1160895459 19:1400106-1400128 GCTGCCTGGAGGAGGGGGTGTGG + Intronic
1160895473 19:1400144-1400166 GCTGCCTGGAGGAGGGGGTGCGG + Intronic
1160927424 19:1553625-1553647 GCTTCCAGGAGGAGGCGAGGAGG - Intergenic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161346568 19:3771403-3771425 GCTTCCTGGAGGAGGGGGTGTGG - Intronic
1161395708 19:4043848-4043870 CCTTCCTGGAGGTGGGGGGGGGG - Intergenic
1161486523 19:4538712-4538734 GCGCCCTGGAGGAGGTTGGCTGG + Exonic
1161574743 19:5049142-5049164 GCTCCCTGGAGGCGGCAGTGGGG + Intronic
1161620586 19:5294931-5294953 GCTTCATGGAGGAGGCTGCCTGG + Intronic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1162027603 19:7903365-7903387 GCTGCCAGCAGGAGGCTAGGAGG + Intergenic
1162535708 19:11262100-11262122 GCTTCCCGGAGGAGGTGGCGTGG - Intronic
1162689109 19:12414122-12414144 GCTGCCGCGAGGAGGCTGTGAGG - Intronic
1162788656 19:13051842-13051864 GGTGCCTGGAGGGGGCGGGGCGG + Intronic
1162989274 19:14291851-14291873 GTTTCCTGGAGGTGGGTGGAGGG + Intergenic
1163155376 19:15437283-15437305 GCTTCCTGGAATGGGGTGGGAGG - Intronic
1163377767 19:16944329-16944351 GCTTCCTGGAGGCAGCTCTGGGG - Intronic
1163692491 19:18745238-18745260 AGTGCCTGGAGGAGGCTGCGGGG + Intronic
1163702444 19:18792866-18792888 GCTTCCTGGAGGAGGTAGCAAGG + Intergenic
1163827358 19:19531062-19531084 GCTTCCTGGAGGAGGAGGCCTGG - Intronic
1164198063 19:22990204-22990226 GTTTCCTGGAGGAAGCAGAGTGG + Intronic
1164434648 19:28218975-28218997 GTTTCCTGGGAGAGGCGGGGAGG - Intergenic
1164636597 19:29796148-29796170 GCTTCCTGGGGCAGGGTAGGTGG + Intergenic
1164705359 19:30315337-30315359 GCTTCCTGGAGGAGGCAGTCAGG + Intronic
1165042731 19:33080777-33080799 TTTCCCTGGAGGTGGCTGGGTGG + Intergenic
1165131619 19:33635773-33635795 GCTTCTTGGAGGAGGCGAGCTGG + Intronic
1165170599 19:33889175-33889197 GGTTCTTGGCGGAGGGTGGGAGG + Intergenic
1165329869 19:35135417-35135439 GCATTCTGGAGCAGGGTGGGAGG + Intronic
1165349271 19:35267586-35267608 GGCTACTGGAGGAGGCTGTGAGG + Exonic
1165421754 19:35725519-35725541 TCTGCCTGGAGGAGGCCGAGCGG + Exonic
1165664724 19:37618321-37618343 GCTTCCAGGAGGAGGAGGTGAGG + Intronic
1165844400 19:38808995-38809017 GCTTCCTGGAGGAGGCCCCCAGG - Intronic
1166378690 19:42343534-42343556 GCGTCCTGTTGGTGGCTGGGGGG + Exonic
1166670754 19:44708252-44708274 GCTTCCTCCATCAGGCTGGGGGG + Intronic
1166763980 19:45241751-45241773 GCTTCCTGGAGGAGGGGGCATGG - Intronic
1167098873 19:47391782-47391804 GCTTCCGGGAGGAGGAAGGTGGG - Intergenic
1167124327 19:47539004-47539026 GCTTCCTGGAGGAGGAGGTATGG - Intronic
1167429885 19:49448089-49448111 GCTTCCTGCAGAGGGCTGGGGGG - Intronic
1167429971 19:49448565-49448587 GCTTCCTGGAGGAGGGGGTGTGG - Intronic
1167512689 19:49904407-49904429 GCCTCCTGGGGGAGTCTAGGAGG - Intronic
1167861141 19:52285000-52285022 CCTTCCTGGAGGATGGTGGTTGG + Intronic
1168217904 19:54939829-54939851 GCTTCCTGGAGGAGGACAGGAGG - Exonic
1168224214 19:54982771-54982793 GCTTCCTGGAGGAGGACAGGAGG + Exonic
1168237435 19:55072086-55072108 GCTGCCTGGAGGAGGAGGGCAGG - Intronic
1168348325 19:55661402-55661424 GGTTGCTGGAGGAGGTTGGGGGG - Intronic
925142904 2:1562286-1562308 GCTTCCAAGAGGAGGCACGGAGG + Intergenic
925184606 2:1838505-1838527 GCTTCCTTGAGGAGGTGGAGGGG - Intronic
925229835 2:2223898-2223920 CCCACCTGGAGGAGGCTTGGTGG - Intronic
925535117 2:4908612-4908634 GCTCCCTGGAGGAGGCTGGCAGG + Intergenic
925917713 2:8618766-8618788 GGTTCCTTCAGAAGGCTGGGAGG + Intergenic
926053197 2:9757664-9757686 GCTGGCTGGAGGGGGCTGGGCGG + Intergenic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
927192889 2:20528904-20528926 GCTTCCTGGAGGAGGTGGCCTGG + Intergenic
927719281 2:25372656-25372678 GCTCCCGGGGGTAGGCTGGGTGG + Intergenic
928201320 2:29249426-29249448 GCTTCCAGGAGGTGGGTGGTGGG + Intronic
928336468 2:30402656-30402678 GCATCTGGGAGGAGTCTGGGAGG + Intergenic
929264067 2:39899000-39899022 GCTTCCTGGAGGATGTTGGGAGG + Intergenic
929901091 2:46004561-46004583 GCTTCCAGAAGCAGGCTGCGGGG - Exonic
930028244 2:47042950-47042972 GACTCCTGGGGGAAGCTGGGGGG - Intronic
930075138 2:47400433-47400455 GATTCCAGGCTGAGGCTGGGCGG + Intergenic
931428213 2:62190146-62190168 GCTTCCTGGAGAAGGTGGAGTGG - Intergenic
931979579 2:67680123-67680145 GGTTTCTGGAGAAGGCTGTGGGG - Intergenic
932714686 2:74092796-74092818 GCATCGTGGGGGAGGCTGGGAGG - Intronic
933632323 2:84672147-84672169 TCTTCCTGCAGGGGCCTGGGTGG + Intronic
934502312 2:94870621-94870643 GCTGCCTGGCGGAGGCTGGATGG - Intergenic
934503989 2:94877917-94877939 GCTTCCTGGAGGAGGGAGCCTGG + Intergenic
936710082 2:115121696-115121718 GCAACCTGGAGGGGGCTGGTGGG + Intronic
937257835 2:120567346-120567368 GGGGCCTGGAGGAGGCTGTGGGG - Intergenic
937307393 2:120880917-120880939 GCTCCCTGGTGGGGGCAGGGGGG - Intronic
937438914 2:121900693-121900715 GCTTCCTGGAGGAGGAGGTGAGG + Intergenic
937767280 2:125676330-125676352 GCTTCCTGGAGGAGTCTTTAGGG + Intergenic
937888805 2:126919392-126919414 GCTTCAGGGTGGAGGCTGGTCGG - Intergenic
937906476 2:127055179-127055201 CCTTCATGGTGGAGGCCGGGTGG - Intronic
938074294 2:128323503-128323525 CCTTCCTGGAGGATGATGGCCGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
938194114 2:129311069-129311091 GCATTCTGGGGAAGGCTGGGAGG - Intergenic
939203057 2:139063066-139063088 CCTTCCTGGAGGTGGGGGGGGGG + Intergenic
939327613 2:140713837-140713859 GCTTTGTGGAGGAGGCTGCAAGG - Intronic
942236597 2:173914579-173914601 GCTTCGTGGAGGAGGTGGGTAGG + Intronic
942469456 2:176244558-176244580 GCTTCTTGGAGGAGGAGGGAGGG - Intergenic
942700507 2:178703229-178703251 GCTTTCTAGAAGAGGCTGGAGGG + Intronic
942990913 2:182201486-182201508 GCTTCCAGGATTTGGCTGGGTGG + Exonic
943179167 2:184521381-184521403 GCTGGCTGGAGGAAGCTGGTTGG + Intergenic
945833045 2:214809378-214809400 GCTTCTTGGGGGTGGCTGCGAGG - Intronic
946276788 2:218637650-218637672 GCTTCTAGGAGGAGGCTTAGTGG + Intergenic
946302295 2:218831350-218831372 CCTTCCTGGAGCAGCCTTGGGGG - Exonic
946442976 2:219712605-219712627 GCTCCATGGAGGAGGCTGAATGG + Intergenic
946758746 2:222972583-222972605 GGTGCCTGGAGGAGGCATGGAGG + Intergenic
947062247 2:226180189-226180211 CCTTTCAGAAGGAGGCTGGGGGG - Intergenic
947422380 2:229952688-229952710 GAGTACTGCAGGAGGCTGGGGGG - Intronic
948048510 2:234961854-234961876 AGTTCCTGGAGGAGGTGGGGTGG + Intronic
948055545 2:235007279-235007301 GCAACCTGGAGGAAGCAGGGAGG - Intronic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
948454233 2:238097336-238097358 GCTGCCTGGCGGAGACTGTGGGG + Intronic
948473770 2:238203547-238203569 GGTCCATGGCGGAGGCTGGGTGG + Exonic
948563383 2:238868327-238868349 GCTTACCAGAGCAGGCTGGGGGG - Intronic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
1169029150 20:2394783-2394805 GCTTTCTGGGGGTGGTTGGGAGG + Intronic
1169119734 20:3088039-3088061 GCTTCCTGGATTAGTCTAGGAGG + Intergenic
1169701331 20:8450150-8450172 ACTTCCAGGAGTAGGATGGGAGG - Intronic
1170143247 20:13146271-13146293 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
1170736085 20:19015282-19015304 CCTTCCTGGAGGAGCATGCGAGG + Intergenic
1171030604 20:21673156-21673178 TCTTCCTGGAGGCAACTGGGGGG - Intergenic
1171389853 20:24794444-24794466 GCTTGCTGGAGGAGTCAGGTAGG - Intergenic
1171449549 20:25226009-25226031 CCTTCCTGCAAGAGTCTGGGAGG + Exonic
1171982693 20:31638640-31638662 GCTCCCCAGAGGAAGCTGGGTGG - Intronic
1172013226 20:31858421-31858443 GCCACCTGGATGATGCTGGGAGG + Intronic
1172573612 20:35989515-35989537 GCTTCCTGGAGGAGGTGAGGTGG + Intronic
1172718994 20:36985012-36985034 GCAACCTGGAGGGGGCTGGTGGG - Intergenic
1172917941 20:38457902-38457924 GCTGCGTGGAGGATGCAGGGAGG + Intergenic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1173774724 20:45694833-45694855 ACTTCCTGGAGGAGAGTGGGTGG - Intronic
1173861388 20:46286055-46286077 CCTTCCTGGAGAGGGCTGGCAGG + Intronic
1174138775 20:48398500-48398522 TGTACCTGGAGGGGGCTGGGGGG + Intergenic
1174165759 20:48582517-48582539 GCTTCCTTCAGGAGGCTCCGGGG - Intergenic
1174402212 20:50282212-50282234 GCTGCCTGGAGGAGGCGATGTGG + Intergenic
1175590207 20:60183746-60183768 GCTCTCAGGAGGAAGCTGGGAGG + Intergenic
1175783064 20:61695953-61695975 GCCTCATGGAGGGGGCTGGTCGG - Intronic
1175793513 20:61757238-61757260 GCCCCCTGGAGGGGGCTGGGGGG - Intronic
1175817547 20:61891380-61891402 GGTTCCAGGGGGAGGCTGTGAGG - Intronic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1175865764 20:62175501-62175523 GCAGCCTGAAGGAGGCTCGGTGG + Intronic
1175923637 20:62461664-62461686 GCTTCCTGGAGGTGTTTGTGGGG - Intergenic
1176080225 20:63268846-63268868 GCTCCCTGGAGAAAGGTGGGTGG + Intronic
1176287018 21:5023658-5023680 GCTTCCTGGGCCAGGGTGGGGGG - Intronic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1176623703 21:9074547-9074569 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1178354351 21:31898113-31898135 GCTTCCAGGAGAAGGCCGAGAGG + Intronic
1178431263 21:32520584-32520606 GACTCATGGAGAAGGCTGGGGGG - Intergenic
1178587571 21:33882832-33882854 GCTACCTGGAGAAGTCTGGCAGG - Intronic
1179172435 21:38982961-38982983 GCTTCCTGGATGGGGCGGGAAGG + Intergenic
1179419724 21:41225812-41225834 CATGCCAGGAGGAGGCTGGGAGG + Intronic
1179546725 21:42117443-42117465 GCATCCTGGAGAATGCTGAGGGG - Intronic
1179597390 21:42452071-42452093 GCTTCCTGGAGGGGGTGGGCTGG - Intergenic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1179870163 21:44239817-44239839 GCTTCCTGGGCCAGGGTGGGGGG + Intronic
1179883253 21:44302139-44302161 GCTTCCTGGCTGCAGCTGGGAGG + Intronic
1179898776 21:44378112-44378134 GCTTCCTGGAGGAATCTTGGGGG - Intronic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1180021694 21:45132554-45132576 GCTACCTTGTGGGGGCTGGGTGG + Intronic
1180228947 21:46414757-46414779 GTGTCCAGGAGGAGGGTGGGCGG - Intronic
1180600497 22:17012297-17012319 GCTTCTTGGAGGAGGAGGGAGGG + Intergenic
1180752157 22:18131918-18131940 GTTTCCTGGAGGATGGTGAGAGG + Intronic
1180798372 22:18619200-18619222 GCTTCCTGCATGAGGCAAGGAGG + Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181021655 22:20106716-20106738 GCTGCCTGGTGGCCGCTGGGCGG + Intronic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181223346 22:21376065-21376087 GCTTCCTGCATGAGGCAAGGAGG - Intergenic
1181255394 22:21559561-21559583 GCTTCCTGCATGAGGCAAGGAGG + Intronic
1181410238 22:22713348-22713370 GACTCCTGGAGGGGGCTGGAGGG - Intergenic
1181417792 22:22772731-22772753 GACTCCTGGAGGGGGCTGGAGGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181848571 22:25733192-25733214 GCTTCCTGCAGAAGGCAGGAGGG + Intergenic
1182256147 22:29040043-29040065 TCTTCCTGGAGGAGGGTGACAGG + Intronic
1183175006 22:36216975-36216997 TCTTCCAGGAGGTGGCAGGGAGG - Intergenic
1183189670 22:36313829-36313851 GCCTTCAGGAGGATGCTGGGTGG + Intronic
1183342155 22:37287391-37287413 ACCTGCTGGAGGAGGCTGAGTGG - Intronic
1183365903 22:37406709-37406731 ACTTCCTGGGGGAGGCTGAGGGG + Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183600964 22:38840450-38840472 GCTGCCTGGAGGAGGATGGAGGG + Intronic
1184150747 22:42636964-42636986 GCTTTCTGGATGAGGGTGGTGGG - Intronic
1184212727 22:43045736-43045758 GATAGCTGGAGTAGGCTGGGTGG - Intronic
1184212735 22:43045775-43045797 GATAGCTGGAGTAGGCTGGGTGG - Intronic
1184212744 22:43045814-43045836 GATAGCTGGAGCAGGCTGGGTGG - Intronic
1184299697 22:43550167-43550189 GGCACCTGGAGGAGCCTGGGGGG + Intronic
1184302673 22:43571595-43571617 CCGCCCTGGAGGAGGCTGGCTGG + Intronic
1185051722 22:48557559-48557581 GCTCCTTGCAGGAGGCTGAGTGG + Intronic
1185130407 22:49035589-49035611 GCTTCCTGGGTGAGGCTTGCTGG + Intergenic
1185302582 22:50090189-50090211 GCTCGCGGGAGGCGGCTGGGAGG + Intronic
949160184 3:872783-872805 GTTCCCTGGAGGTGCCTGGGAGG - Intergenic
950032686 3:9862847-9862869 GCTTCCCAGCGCAGGCTGGGTGG + Intergenic
950090656 3:10291933-10291955 GCAGCATGGAGAAGGCTGGGTGG + Intronic
950110361 3:10414772-10414794 GCTGCCTGGAAGAGGGAGGGAGG - Intronic
950437969 3:12992092-12992114 GCTTCCTGGGGAATGCTCGGAGG - Intronic
950661149 3:14467779-14467801 GCTTCCTGGAGGAGGCAGCGAGG - Intronic
950681105 3:14585674-14585696 TCCTCCTGAAGGAAGCTGGGGGG - Intergenic
951463305 3:22974418-22974440 GCTTTCTGGAGGAGTCTTTGGGG - Intergenic
952236666 3:31487160-31487182 GCTTCCTGGAGGAGTGTGGAGGG - Intergenic
952390338 3:32874242-32874264 GATTTCGGGAGGTGGCTGGGTGG - Intronic
952406988 3:33013805-33013827 TCTTCTTGGAGGAGGCAGGATGG + Intronic
953710323 3:45264492-45264514 GCTTCCTGGGGCAGGGTGTGAGG + Intergenic
954036212 3:47852610-47852632 GCTCCGTGGAGGAGGTTGGGAGG - Exonic
954039097 3:47870809-47870831 TCAGCCTGGAGGAGGCCGGGTGG - Exonic
954418216 3:50404551-50404573 GCTTCTTGGAGGAGGATGTTGGG - Intronic
954797474 3:53168856-53168878 GCTGCATGGAGCAGGCTGAGGGG + Intronic
955514138 3:59709904-59709926 GGGACCTGGAGGGGGCTGGGTGG - Intergenic
955835225 3:63047303-63047325 GGTTCCTGTGGGAGGGTGGGAGG - Intergenic
956054587 3:65285215-65285237 GCTTCCTGAAAGAGGCTCTGTGG - Intergenic
956206798 3:66763086-66763108 GCTTCCTGGAGCTGGCTGGAAGG + Intergenic
956236105 3:67072666-67072688 GCTTGATGGTGGAGGGTGGGAGG - Intergenic
956870136 3:73408576-73408598 GATTCTTGGAGGAGGGGGGGGGG + Intronic
957484482 3:80840559-80840581 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
960589406 3:119350960-119350982 GCTTCTTGGATGACACTGGGAGG - Intronic
960906125 3:122603333-122603355 TCTTCCTTGAGTAAGCTGGGTGG - Intronic
961349613 3:126291584-126291606 GCTCCCTGGAGGAGGGAAGGAGG + Intergenic
961445064 3:126976540-126976562 GCTTCCTGGAGGAGGGGAGAAGG + Intergenic
961605767 3:128094439-128094461 GCTGCCTGGAGGTGGCAGTGGGG - Intronic
961820212 3:129572028-129572050 GCTTCCTGGAGGAGGTGGGATGG - Intronic
963176470 3:142303063-142303085 GCTTTCTGGAGGAGTCTTTGTGG - Intergenic
963641643 3:147867695-147867717 GCTTTCTTTATGAGGCTGGGTGG + Intergenic
963938299 3:151076520-151076542 GCAACCTGAAGGAGGCGGGGAGG - Intergenic
966809473 3:183830509-183830531 GCTTCCTGGAGGATGTGGGGTGG + Intronic
966938528 3:184730461-184730483 CCTTCCTGGAGGTGACTTGGGGG + Intergenic
967118933 3:186365491-186365513 GCTTCATGGAGGAGGAGGGCTGG + Intergenic
967189884 3:186975961-186975983 GTTTCCTATGGGAGGCTGGGAGG - Intronic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
968229103 3:196994175-196994197 GCTTCCTGCTGGAGTCTGGGGGG + Intronic
968494469 4:907694-907716 GCTCACTGGAGGAGGCCTGGAGG - Intronic
968521787 4:1037512-1037534 GCTGCCTGCAGGAGGCTGGTCGG - Intergenic
968521807 4:1037592-1037614 GCTGCCTGCAGGAGGCTGGTCGG - Intergenic
968543510 4:1181611-1181633 GCTTCCAGGAGTAGGTTTGGAGG + Intronic
968662064 4:1802774-1802796 GCTGCCTGGAGGAGGCGTGGAGG - Intronic
968734441 4:2288145-2288167 GCTTCCTGGAGGAGGCGGCCTGG + Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969488303 4:7484826-7484848 GCTGCGTGGAGGAGGCAGGCTGG - Intronic
969653091 4:8479037-8479059 GCTTCCTGGAGGAGGGGCTGAGG + Intronic
970945302 4:21683971-21683993 GCTTGAGGGAGGAGGGTGGGAGG + Intronic
971073908 4:23126238-23126260 GATCCCTGGAGGAGGCTCTGGGG + Intergenic
972330179 4:38057115-38057137 TCTTCCTGCAGGAGATTGGGTGG - Intronic
973026370 4:45277314-45277336 CCTTACTGTAGGAGGGTGGGAGG - Intergenic
973741044 4:53919798-53919820 GCTTGCTGGGAGAGGCGGGGTGG + Intronic
974458261 4:62156223-62156245 GCTTCCTTGTGGAGGCTCTGAGG - Intergenic
975688045 4:76937384-76937406 TCTTCCTGGAGGAGTTTGGGTGG + Intergenic
977937858 4:102827182-102827204 GCGTGGTGGAGGTGGCTGGGCGG - Intronic
978545900 4:109872674-109872696 GCTTCTAGGAGGAGGGTGGTAGG + Intergenic
978574364 4:110173828-110173850 ACTTGATGGAGGAGGTTGGGAGG + Intronic
979294779 4:119019056-119019078 ACTTGATGGGGGAGGCTGGGAGG + Intronic
984869059 4:184310951-184310973 CTTTGCTGGAGGAAGCTGGGAGG - Intergenic
985093252 4:186385686-186385708 GCTTTCTGGAGGAGCCTTGAGGG - Intergenic
986047822 5:4057573-4057595 GCTTTCTGGAGGAGACTTTGGGG - Intergenic
986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG + Intergenic
986464945 5:8011785-8011807 GCTTCTTGCAGGAGGGAGGGAGG - Intergenic
988504228 5:31807794-31807816 GCTGGCAGGAGGGGGCTGGGGGG + Intronic
990327729 5:54694683-54694705 GCTTCCTGGAGGGGGCTCTGAGG + Intergenic
991293535 5:65057735-65057757 GCCTACTGGAGGAGGTAGGGTGG - Intergenic
992744891 5:79809887-79809909 GCTTCCAGCAGGAGCCAGGGTGG - Intergenic
994094320 5:95835141-95835163 ACTTCCTGGAGGCGGCGGCGAGG - Intergenic
994164623 5:96595902-96595924 GCTTCCTGGAGGAGGTGGCGTGG + Intronic
994353145 5:98769318-98769340 GCTGCCTGGAGGAAGCTGCTGGG + Exonic
994714258 5:103302959-103302981 GCTTGCTGGAGGAGGCAGCCAGG + Intergenic
995522119 5:113018639-113018661 GTTTCCTGCAGGTGGTTGGGTGG + Exonic
995722977 5:115155903-115155925 GCTTTCTGGAGGAGGCTTTAGGG - Intronic
996716804 5:126594947-126594969 GCTCGCTCGAGGAGGCCGGGCGG - Intronic
997372343 5:133370041-133370063 GCTTCCTGGAGGAGGGGGATTGG - Intronic
997381620 5:133442086-133442108 TCCTCCTGGAGGATGCTGTGTGG - Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
998129342 5:139643483-139643505 GCCTGCTGGAGGAGGCAGGGTGG - Intergenic
998134418 5:139667253-139667275 GCTTCTTGGAGGAGGTGAGGTGG - Intronic
998324915 5:141271899-141271921 TCTTCCTGGAGGTTGCAGGGTGG - Intergenic
999077153 5:148807148-148807170 GGTGGCTGGAGTAGGCTGGGTGG + Intergenic
999679096 5:154038827-154038849 GCTTCCTGAACGAGGCAGGAGGG - Intronic
1000040414 5:157480825-157480847 GGTTCCTGGAGGAGGGTGGGAGG + Exonic
1001695391 5:173666096-173666118 GCTTTCTGGAGGAGTCTTGAGGG - Intergenic
1002103385 5:176868343-176868365 GCTTCCTGGAAGAGGCGGTCCGG + Intronic
1002104560 5:176873698-176873720 GCTGCCTGGAGGATGCAGGAGGG - Intronic
1002180635 5:177429362-177429384 GCTGCCTTGATGTGGCTGGGAGG + Intronic
1002323434 5:178389281-178389303 GCTTCCTGGAGGAGGTGGCCAGG - Intronic
1002455308 5:179342876-179342898 GCTTCCTGGAGAGGGCAGGAGGG - Intronic
1002524638 5:179808101-179808123 GGTTCCTGGTGGAGGCTGCAGGG + Intronic
1002617921 5:180467091-180467113 GCTTCCTGGAGGAGGAGGCAGGG + Intergenic
1002890413 6:1326944-1326966 CCCTCCTGGAGGAGGCTCAGGGG + Intergenic
1002915067 6:1522560-1522582 GCTTCTTGGAGGAGGAGGCGGGG - Intergenic
1003206909 6:4021210-4021232 GCTTCCGGGAGCATGGTGGGCGG - Intergenic
1004077636 6:12359308-12359330 AGTTCCTGGAGGAGGCAGGATGG - Intergenic
1004803615 6:19178441-19178463 ATTTCCTGGAGGAGACTGGTTGG + Intergenic
1004868377 6:19876994-19877016 GCTTCCTGGGGGACTCTTGGTGG - Intergenic
1005886275 6:30100366-30100388 GCTTCCCGGAGGAGGTGAGGTGG + Intergenic
1006131558 6:31872093-31872115 GCTTCCTGGAGGAGGTGAGATGG - Intronic
1006224230 6:32522480-32522502 GCTCCCAGGAGGAGGCGGCGCGG - Intronic
1006228212 6:32558492-32558514 GCTCCCAGGAGGAGGCTGCACGG - Intronic
1006230824 6:32584682-32584704 GCTCCCAGGAGGAGGCGGCGCGG - Intronic
1006334789 6:33414913-33414935 GTGTCCGGGAGGGGGCTGGGGGG + Intronic
1006424661 6:33956525-33956547 GCTTCCTGGGGCTGGCTGTGAGG + Intergenic
1006517228 6:34551810-34551832 GCTGGCTGGAGGAGGCGGGGAGG - Intronic
1007255544 6:40525726-40525748 GCTTCCTGGAGGAGGTGAGATGG - Intronic
1007350937 6:41273009-41273031 GCTGCCGGGAGAAGGGTGGGAGG - Intronic
1007373709 6:41442867-41442889 GCTTCCTGGAGGAGGTGGCTGGG + Intergenic
1007419926 6:41713197-41713219 GCACCCTGGTGCAGGCTGGGTGG - Intronic
1007427485 6:41756881-41756903 GCTACATGGAGGAGGCAAGGTGG - Intergenic
1007504948 6:42328492-42328514 GCTTGAGGGTGGAGGCTGGGAGG - Intronic
1007509069 6:42361767-42361789 GCTGCCTGAAGGAGGATGGAGGG - Intronic
1007687743 6:43677086-43677108 GTTTCCTGGAAAAGGCTGGTAGG + Intronic
1007738977 6:43999778-43999800 TCTTCCTGGGGAAGGATGGGAGG - Intergenic
1007891248 6:45294576-45294598 GCTTTCTGGAGGAGGCTTTAGGG - Intronic
1008130022 6:47710614-47710636 GCTTCCTGGAGGAGGCAATTGGG - Intronic
1010206063 6:73323474-73323496 CTTTCCTGCAGGAGGGTGGGAGG - Intergenic
1011340455 6:86307723-86307745 GCTTCTTGGTGGAGGCTGGGGGG - Intergenic
1011343340 6:86341224-86341246 GCTTCCTAGAGGTGGGTGAGGGG - Intergenic
1011638819 6:89400707-89400729 GCCTTCTGCAGGAGGCTGAGAGG - Intronic
1011797929 6:90978036-90978058 GCTTCCTTCTGGAGGCTGTGGGG - Intergenic
1012135328 6:95548636-95548658 GCCTCCTAGAGGAGGTTGTGGGG - Intergenic
1012392333 6:98756665-98756687 GCCTCCTGGAGGAGGAAAGGGGG - Intergenic
1013883585 6:114934167-114934189 GCTTCTTGGAGGGAGATGGGAGG + Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1017124256 6:151051017-151051039 CCTTCCTGGAGGTTGATGGGTGG + Intronic
1017710607 6:157164010-157164032 GATTCCTGGAGGAAGGTAGGTGG - Intronic
1017754490 6:157518022-157518044 GCAGGCTGGAGGAGGGTGGGGGG + Intronic
1018334285 6:162769080-162769102 GCTTCCTGGAAGAGGCCTTGAGG + Intronic
1019301608 7:307019-307041 ACTTCCTGGAGGAGGCAGCCTGG - Intergenic
1019520283 7:1457830-1457852 GGGTCCTGGATGAGGCTGGCTGG - Intronic
1019634326 7:2067405-2067427 GCTTCCTGGGGGAGGAAGAGTGG - Intronic
1019917931 7:4145203-4145225 GGTCCCTGGAGGGAGCTGGGGGG + Intronic
1020271956 7:6602172-6602194 GCTTGCTGGAGCAGGGTGGAGGG + Intronic
1020385715 7:7600011-7600033 GCTTACTGGAGGGTGCTAGGTGG + Intronic
1022529119 7:31056236-31056258 GCTTCCTGGAGGTGGTGGTGGGG + Intronic
1023682669 7:42703448-42703470 CCTTCCTGGAAGAGGCAAGGAGG + Intergenic
1023995299 7:45155980-45156002 GCTCCCTGGTGCAGGCTTGGGGG + Intergenic
1024920875 7:54553597-54553619 TCTTGCTGGAGGAGTCAGGGAGG + Intronic
1025218852 7:57086782-57086804 GCTACATGTCGGAGGCTGGGAGG + Intergenic
1025603105 7:63017806-63017828 GTTTCTGGGAGGTGGCTGGGAGG + Intergenic
1025629773 7:63260370-63260392 GCTACATGTCGGAGGCTGGGAGG + Intergenic
1026443750 7:70465872-70465894 GCTTGCTGGGGGAGACAGGGTGG + Intronic
1026830624 7:73607796-73607818 ACTTCCTGGAGGAGGCAGCATGG - Intronic
1026882923 7:73919068-73919090 GCTTCCTGGAGGAGGCGGAGTGG + Intergenic
1026897978 7:74021598-74021620 GCTCCCTGCAGGCGGCTGTGTGG + Intergenic
1026916398 7:74122440-74122462 GGTTCCTGGATGGGGGTGGGTGG - Exonic
1026950041 7:74340842-74340864 GCTTCCTGGGGGAAGGTGGTTGG + Intronic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027189567 7:75989057-75989079 GGTTCCGGGGGAAGGCTGGGTGG + Intronic
1027249471 7:76389993-76390015 GCTTCCTGGAGGAGGAAGGGAGG + Exonic
1027250911 7:76398110-76398132 GCTTCCTGGAGGAAGAGGTGTGG - Intronic
1028343970 7:89757768-89757790 GATTCTTGGAGGTGGTTGGGTGG - Intergenic
1028847595 7:95499676-95499698 GATTGCTGGAGGGGGCTGGAGGG + Intronic
1029179280 7:98688270-98688292 GCTTCCAGGAGGAGGTGGGCTGG + Intergenic
1029597526 7:101545623-101545645 GCTTCCTGGAGGAGGCCTGCAGG - Intronic
1029599222 7:101553941-101553963 GCTTCTGGGAGGAGGAGGGGAGG + Intronic
1029630326 7:101746262-101746284 GCTTCCTGGAAGGGTCTGGAAGG - Intergenic
1029746100 7:102516615-102516637 GCTGCCTGGAGGAGGAGGGTGGG - Intronic
1029764038 7:102615594-102615616 GCTGCCTGGAGGAGGAGGGTGGG - Intronic
1030109152 7:106011764-106011786 GCTTGCTGTAGGAGGCTCTGAGG - Intronic
1031052347 7:116956520-116956542 GCTTCCTTGAGGAGGAAGGGAGG - Exonic
1031351937 7:120743598-120743620 GCTTCCTGGAGGAACTTGAGTGG + Intronic
1032195235 7:129784884-129784906 TCTTTCTGGAGAAGGCTGGGAGG + Intergenic
1033260058 7:139835877-139835899 GCTTTCTGGAGGAGGCCTGAGGG - Intronic
1033496887 7:141907846-141907868 ACTTCTTGCAGGAGGCTGTGTGG + Intronic
1034311781 7:150094970-150094992 GGTTGCTGGTGGGGGCTGGGGGG - Intergenic
1034422730 7:150997868-150997890 GGCCCCAGGAGGAGGCTGGGAGG - Intronic
1034540644 7:151755939-151755961 GGTTCCTCCAGGAGGCTGCGGGG + Intronic
1034590075 7:152131311-152131333 ACTTCCTGGAGCAGGCCAGGCGG + Intergenic
1034638449 7:152585539-152585561 CCTTCCGGGAGGAGGTGGGGGGG - Intergenic
1034707244 7:153156648-153156670 GGCTGCTGGAGGAGCCTGGGAGG + Intergenic
1034795073 7:154005684-154005706 GGTTGCTGGTGGGGGCTGGGGGG + Intronic
1034853589 7:154519264-154519286 TTATGCTGGAGGAGGCTGGGAGG + Intronic
1035105095 7:156435337-156435359 GCTGCATGGAGGAGGCAGGCAGG + Intergenic
1035264704 7:157684620-157684642 TCTTTCTGGAAGAGGCTGTGTGG - Intronic
1035997085 8:4560116-4560138 GCTTCCTGGAGCAGCTTGGAGGG - Intronic
1036162896 8:6406151-6406173 GCTCCCCGGAGCAGGCAGGGCGG + Intergenic
1036380332 8:8232440-8232462 GCTTTATGGAAGAGGCGGGGAGG - Intergenic
1036477107 8:9103328-9103350 GCTTCCTGGAGGAGGTGAGGTGG - Intronic
1037877165 8:22553950-22553972 GCTTCCTGGAGGGCAGTGGGCGG + Intronic
1038576038 8:28703614-28703636 GTCTTCTGGAGGAGGGTGGGAGG + Intronic
1039101707 8:33948456-33948478 GTTTCCTGGAAGAGTCTAGGAGG + Intergenic
1039518671 8:38153259-38153281 GTTTCCTGGAGGAGGTTTTGAGG - Intergenic
1039804654 8:40987732-40987754 GCCTCCTGGAGCAGGATGGCTGG + Intergenic
1040550287 8:48432191-48432213 GCTTCCTGGAGGAGGAGGGCAGG + Intergenic
1040603787 8:48910141-48910163 ACTTCCAGGAGGTGGGTGGGAGG - Intergenic
1041107844 8:54459097-54459119 CCTTCGTGGAGGAGGCAGAGCGG + Exonic
1042621557 8:70711617-70711639 GCTTACTTGAGGATGCAGGGTGG + Intronic
1042621588 8:70711821-70711843 GCTTACTTGAGGATGCAGGGTGG + Intronic
1043568480 8:81573846-81573868 GCTTTCTGGAGGAGTCTTTGTGG + Intergenic
1044285514 8:90408278-90408300 GGCTAGTGGAGGAGGCTGGGAGG - Intergenic
1045765425 8:105662120-105662142 GCGTGATGGAGGAGGCAGGGAGG + Intronic
1048550881 8:135432827-135432849 GTATCCTGGATGAGGCAGGGAGG + Intergenic
1049030412 8:140032409-140032431 GCTGGCTGGAGGAGGGTGGGGGG - Intronic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049199708 8:141334091-141334113 ACTTCCTGGAGGAGGAGGGCTGG + Intergenic
1049288686 8:141790488-141790510 GCTGCCAGGAGGAGGCTGCTGGG + Intergenic
1049309516 8:141925893-141925915 ACTTCCAGGAGGAGGGAGGGGGG + Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049478644 8:142809537-142809559 GCTTCCTGGAGAAGGCCAGGTGG + Intergenic
1049562109 8:143317085-143317107 GCTTCCTGGAGGAGGCGCCGAGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049665581 8:143841218-143841240 GCTTCGCGAAGGAGGCTTGGAGG - Intergenic
1049708788 8:144054553-144054575 TCTTCCAGGAGGAGGGTGAGTGG - Exonic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049808257 8:144551198-144551220 GGTTGCTGGGGGAGGATGGGGGG + Intronic
1050243176 9:3659312-3659334 GCTTCCTGCACGGGGCTGTGAGG - Intergenic
1052951209 9:34213770-34213792 GCTTTCTGGAGGAGGCTTTAGGG - Intronic
1053070877 9:35101265-35101287 GCTTCCAGGTGGAGGCAGAGCGG - Exonic
1053350762 9:37411944-37411966 GCTTCCTGGAGGAGGAGGCATGG - Intergenic
1053432603 9:38052920-38052942 GCTTCATGGAGGAGGCAGCATGG - Intronic
1054810696 9:69431520-69431542 GGTCCCTGGTGGTGGCTGGGCGG - Intronic
1055748828 9:79481439-79481461 GTTTCCTTGAGGTTGCTGGGGGG + Intergenic
1056765092 9:89440231-89440253 GCTTCCTGGCAGGGGCGGGGAGG - Intronic
1057174369 9:92985225-92985247 GAAACCTGGAGGAGGCTGGTGGG + Intronic
1057829789 9:98397708-98397730 GCTTCCTGGAAGAGGCAGGTAGG - Intronic
1058861374 9:109120144-109120166 TCTTCCTGGAGGGGGGGGGGGGG + Intergenic
1059432783 9:114260062-114260084 GCTTCCTGGGGCAGGAGGGGAGG - Intronic
1059742362 9:117164554-117164576 GCTACCTGGAGGGGATTGGGGGG - Intronic
1060775003 9:126366744-126366766 GCTCAGTGCAGGAGGCTGGGTGG - Intronic
1061084374 9:128390584-128390606 GCTTCCTGCAGGAGGTGGGAAGG - Exonic
1061290700 9:129649074-129649096 GCTTCCTGGTGGGGGCGGGTAGG - Intergenic
1061393716 9:130331985-130332007 CCTTCCAGGAGAAGGGTGGGTGG - Intronic
1061498616 9:130989918-130989940 GCTGCCTGGAGGATGGCGGGAGG + Intergenic
1061868658 9:133508333-133508355 GCTGCCTGGAAGAGGCAGGTTGG - Intergenic
1061899798 9:133666932-133666954 GCGGCCTGGAGGAGAATGGGGGG + Intronic
1061949181 9:133926675-133926697 GCTTCCTGGAGGAGGTGCTGGGG - Intronic
1061988551 9:134144726-134144748 GCTACTTGGAGGACGGTGGGAGG + Intronic
1062049237 9:134438585-134438607 GCTTCCTGGCAGTGCCTGGGAGG - Intronic
1062053629 9:134459585-134459607 GCTTCCTGGAGGAGGGGTTGGGG - Intergenic
1062069871 9:134549876-134549898 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069875 9:134549890-134549912 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069880 9:134549904-134549926 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069888 9:134549932-134549954 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069893 9:134549946-134549968 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069897 9:134549960-134549982 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069902 9:134549974-134549996 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069911 9:134550002-134550024 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069915 9:134550016-134550038 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069920 9:134550030-134550052 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069925 9:134550044-134550066 GCTGGGTGGAGGAGGCTGGGTGG + Intergenic
1062069930 9:134550058-134550080 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069935 9:134550072-134550094 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069939 9:134550086-134550108 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069943 9:134550100-134550122 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069948 9:134550114-134550136 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069958 9:134550142-134550164 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069981 9:134550205-134550227 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069986 9:134550219-134550241 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069990 9:134550233-134550255 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062069995 9:134550247-134550269 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062069999 9:134550261-134550283 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062070004 9:134550275-134550297 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062070009 9:134550289-134550311 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062070014 9:134550303-134550325 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062070018 9:134550317-134550339 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062070022 9:134550331-134550353 GCTGGGTGGAGAAGGCTGGGTGG + Intergenic
1062070027 9:134550345-134550367 GCTGGGTGGTGGAGGCTGGGTGG + Intergenic
1062079997 9:134618752-134618774 GCTTCCTAGAGAAGGGTGTGGGG + Intergenic
1062103658 9:134741044-134741066 GCTTCCTGAACAAGGCTGGCCGG - Intronic
1062422517 9:136490007-136490029 GCATCTTGAAGGTGGCTGGGTGG - Intergenic
1062629415 9:137457124-137457146 GCTTCCTGGAGGAGGGGGCCTGG - Intronic
1203746888 Un_GL000218v1:44975-44997 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1186155140 X:6717505-6717527 GCTTCCAGGAGGAGTCTGGTAGG - Intergenic
1186252750 X:7686595-7686617 ACTTGCTGGTGGAGGGTGGGAGG + Intergenic
1186429560 X:9493280-9493302 ACTTCCTGGAGGAGCCAGGCAGG - Intronic
1186530421 X:10289914-10289936 GCTTTCTGGAAGAGACTGGGTGG - Intergenic
1187182850 X:16959209-16959231 GCTACCTGGGGGGGCCTGGGTGG - Intronic
1192260497 X:69503807-69503829 GCGTCCTGGAGGGGGCAAGGCGG - Intergenic
1193906620 X:87252963-87252985 GCACCCTGGAGGAAGCTGGTAGG + Intergenic
1194932313 X:99902284-99902306 GCTTCCTGGAGGAGTCTTTGTGG - Intergenic
1195129693 X:101840226-101840248 GCACACTGGAGGAGGCTTGGTGG + Intronic
1195176545 X:102319603-102319625 GCACACTGGAGGAGGCTTGGTGG - Intronic
1195182319 X:102367490-102367512 GCACACTGGAGGAGGCTTGGTGG + Intronic
1195202412 X:102564295-102564317 GCACACTGGAGGAGGCTTGGTGG - Intergenic
1195255033 X:103082006-103082028 GCACGCTAGAGGAGGCTGGGTGG + Intronic
1195276882 X:103289882-103289904 GCATGCTGGATGGGGCTGGGGGG - Intergenic
1195727333 X:107932011-107932033 GCCTGCAGGAGGAGACTGGGAGG + Intergenic
1195968377 X:110449545-110449567 GCTTATTGGAGCAGGCTGGAGGG + Intronic
1196235442 X:113274403-113274425 GTTTCCAGGAGGAGGCTGAGAGG - Intergenic
1197185096 X:123577224-123577246 TCTTCCTGGTGTAGTCTGGGAGG - Intergenic
1197346040 X:125326665-125326687 TCTTCCAGGAGAAAGCTGGGGGG - Intergenic
1198414049 X:136401872-136401894 GCCTCCTGGAGGAGATAGGGAGG + Intronic
1198433086 X:136587506-136587528 GCTTCCTGGAGGAGGTGATGTGG + Intergenic
1198616850 X:138467437-138467459 GCTTTCTGGAGGAGTCTTTGGGG - Intergenic
1199411546 X:147529328-147529350 GTTTCCTGGACTAGGCTGGTGGG - Intergenic
1199996186 X:153028220-153028242 CCTTGCTGCAGGAGTCTGGGTGG + Intergenic
1200120847 X:153789862-153789884 GCTTCCTGGAGGAGGTGCGGGGG - Intronic
1201158557 Y:11152701-11152723 GCTTCCTGGAGGAGGGAGCCTGG - Intergenic
1201160213 Y:11159989-11160011 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1201762108 Y:17551775-17551797 ACTTGATGGAGGAGGGTGGGAGG + Intergenic
1201839444 Y:18354213-18354235 ACTTGATGGAGGAGGGTGGGAGG - Intergenic