ID: 997617184

View in Genome Browser
Species Human (GRCh38)
Location 5:135255545-135255567
Sequence TAGACAACTCTCTGTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997617177_997617184 21 Left 997617177 5:135255501-135255523 CCACTGAGAGCTTACACAAAAAA 0: 1
1: 0
2: 1
3: 36
4: 324
Right 997617184 5:135255545-135255567 TAGACAACTCTCTGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997617184 Original CRISPR TAGACAACTCTCTGTGGTGC AGG Intronic
No off target data available for this crispr