ID: 997620662

View in Genome Browser
Species Human (GRCh38)
Location 5:135290510-135290532
Sequence GTGGCTTAACTAGGTACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997620662_997620665 -3 Left 997620662 5:135290510-135290532 CCTGAGGTACCTAGTTAAGCCAC 0: 1
1: 1
2: 1
3: 17
4: 106
Right 997620665 5:135290530-135290552 CACACTCAGATTCCTGACCCTGG 0: 1
1: 0
2: 4
3: 31
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997620662 Original CRISPR GTGGCTTAACTAGGTACCTC AGG (reversed) Intronic
909112508 1:71496884-71496906 GTGGCTTAACTAGCTACAAAGGG - Intronic
911126027 1:94341646-94341668 ATGGCTTAGCTAGGTACCTCTGG - Intergenic
911748292 1:101465936-101465958 GTGGCTTACCTGGGAGCCTCTGG + Intergenic
915347079 1:155202988-155203010 GTGGCTTAAATAGTGACCACCGG - Intronic
915964749 1:160296621-160296643 ATGGCTTAGCTAGGTGCCTCCGG - Intronic
916021341 1:160795385-160795407 ATGGCTTAGCTGGGTGCCTCTGG + Intergenic
1063869443 10:10401921-10401943 GGGGCTTTACTAGGGCCCTCAGG - Intergenic
1065205967 10:23357987-23358009 TTGGCAAAACAAGGTACCTCTGG + Intergenic
1069424093 10:68274551-68274573 GTAGCATAGCTGGGTACCTCTGG + Intergenic
1072759865 10:98047648-98047670 GTGGCTTAGCTGGGTAGTTCTGG - Intergenic
1077639006 11:3864352-3864374 ATAGCTTGACTGGGTACCTCTGG + Intronic
1077955295 11:7012918-7012940 GTGGCTTAGCTAGGCAGCTCTGG + Intronic
1077974432 11:7232825-7232847 GTGGCTTAGCTGGGTACTTTTGG - Intergenic
1078757802 11:14227774-14227796 GTGGCTTAACTGTGTAACCCTGG - Intronic
1078807692 11:14722743-14722765 GTGGCTTAGCTGAGTGCCTCTGG - Intronic
1082007751 11:47429336-47429358 TTGGCTGAATTAGGGACCTCTGG + Intergenic
1085434512 11:76487777-76487799 TAGGCATAACGAGGTACCTCGGG - Intronic
1085634205 11:78145647-78145669 GTGGCTTAGCTAGGTGGTTCTGG + Intergenic
1087153448 11:94879169-94879191 GTGGCTTCACAAGGTACCTGGGG - Intergenic
1088599753 11:111463733-111463755 GCAGCTTAGCTGGGTACCTCTGG + Intergenic
1092480297 12:8853476-8853498 GCAGCTTAGCTGGGTACCTCTGG + Intronic
1102774049 12:115503511-115503533 GTGGCTTAACTGGGTGGCTCTGG + Intergenic
1105623966 13:22095235-22095257 ATGGCTGCACCAGGTACCTCTGG - Intergenic
1106674131 13:31939795-31939817 ATGTCTTAACTAACTACCTCTGG - Intergenic
1109958063 13:69594516-69594538 CTGGTTTAAATATGTACCTCGGG - Intergenic
1113430289 13:110244574-110244596 CTGGCTGAGTTAGGTACCTCTGG - Intronic
1115783929 14:36802983-36803005 ATTGCTTAGCTAGGTGCCTCTGG + Intronic
1117245602 14:53882266-53882288 CTGGCTTAAATACGTTCCTCTGG + Intergenic
1118243515 14:64084791-64084813 ATGGCTTAGCTAAGTATCTCTGG + Intronic
1118635168 14:67742178-67742200 GTGACTACTCTAGGTACCTCAGG - Intronic
1119980571 14:79076353-79076375 GTGGCTTAGCTGGGTGCCTCTGG + Intronic
1120563207 14:86022283-86022305 ATGCCTTAGCTAGGCACCTCTGG + Intergenic
1122834968 14:104426306-104426328 GTGGCAGAACTGGGTGCCTCTGG + Intergenic
1125469239 15:39986409-39986431 GTGGCTTGACCAGGAACCTCTGG + Intronic
1125853217 15:42923891-42923913 GTGGCTTAGCTGGGTAGTTCTGG - Intergenic
1126929712 15:53634219-53634241 CCTGCTTAACTAGGAACCTCAGG + Intronic
1127077262 15:55338917-55338939 GTTGCTTAGCTGGGTGCCTCTGG - Intronic
1128302982 15:66578835-66578857 ATGCCTTAACTGGGTGCCTCTGG - Intergenic
1131011793 15:89023822-89023844 GTGGCTTAGTTAGGTGGCTCTGG - Intergenic
1132017886 15:98335067-98335089 TTGGCTTAACAAGCTACCTAAGG - Intergenic
1148993645 17:51688269-51688291 GTGGCTTAGCTGGGTAGTTCTGG - Intronic
1149487010 17:57050378-57050400 ATGGCTTAGCTGGGTGCCTCTGG + Intergenic
1150958715 17:69891258-69891280 ATGGCCTTACTGGGTACCTCTGG + Intergenic
1156202249 18:34847500-34847522 TTGGCTTAGCTAAGTCCCTCTGG + Intronic
1156449157 18:37256955-37256977 GTGGCTTAACCAGGAACAGCTGG + Intronic
1158895631 18:61910171-61910193 GTGGCTTAGCTAGGTGGTTCTGG + Intergenic
1159295603 18:66482958-66482980 GTGGCTTCAAGAGCTACCTCAGG - Intergenic
1159358153 18:67363768-67363790 GTGGCTTAGCTGGGTGTCTCTGG + Intergenic
1166549903 19:43658365-43658387 GTGGCTTAGCTAGGTGGTTCTGG - Intronic
928691199 2:33801101-33801123 GTGGCTTAACTCAATTCCTCTGG + Intergenic
935963522 2:108449651-108449673 GTGGCTTCACCAGCTACCCCTGG + Exonic
938302481 2:130227105-130227127 GTGGCTGAAATAGGAACATCAGG - Intergenic
938454202 2:131447147-131447169 GTGGCTGAAATAGGAACATCAGG + Intergenic
1169058586 20:2643615-2643637 GTGGCTTAACTAGGCAGATGTGG + Intergenic
1172214696 20:33227038-33227060 GTGGCTGAAAGAGGTACCCCCGG + Intronic
1178084724 21:29101147-29101169 GTGGCTTCGCTGGATACCTCAGG + Intronic
1178560967 21:33639463-33639485 GTGGCTTAATTATGTGACTCTGG + Intronic
1181118183 22:20647230-20647252 GTGGATTAACTAGGTGCTACTGG + Intergenic
1182542289 22:31050386-31050408 ATGGCTTAATTAGGTAGTTCTGG + Intergenic
1184234859 22:43177766-43177788 GTGGCTCAACGGGGTGCCTCTGG - Intronic
1184952959 22:47858558-47858580 GTGGCTTAGTTGGGTACCTCTGG + Intergenic
952389910 3:32871147-32871169 GGGGCCTGACTGGGTACCTCCGG - Intronic
952815197 3:37441685-37441707 GTGGCTTATCTGGGTGCTTCTGG + Intergenic
958925354 3:100151337-100151359 ATGGCTTAACTCAGTGCCTCTGG + Intronic
959229250 3:103626662-103626684 ATAGCCTAACTATGTACCTCAGG - Intergenic
960655415 3:119998480-119998502 ATGGCTTAGCTAGGAACCTCTGG - Intronic
962981973 3:140498727-140498749 GTGGCTAAAGTGGGTACCTGAGG + Intronic
963688946 3:148474005-148474027 GCAGCTTAACTAGGTAGTTCTGG + Intergenic
964027891 3:152099974-152099996 GTGGCTTAGCTGGGTGCTTCTGG - Intergenic
965548586 3:169940114-169940136 GTGGCTTAGCTGGGGGCCTCTGG - Intergenic
965994251 3:174860032-174860054 TTGGCTTGACTAGGCATCTCTGG + Intronic
970034934 4:11722602-11722624 GTGGCTTACCTAGGTGGTTCTGG - Intergenic
970944370 4:21672777-21672799 GTGGCTTAGCTGGGTGCTTCTGG + Intronic
972967029 4:44523262-44523284 GTGTCGTGACTAGGTACATCTGG + Intergenic
973843687 4:54889243-54889265 GTGGCTTAGCTAGGTACCTCTGG - Intergenic
976426345 4:84907590-84907612 GTGGTTTAACTAGGTGGCCCTGG - Intronic
977927275 4:102715377-102715399 GTGGCTCAGCTGGGTGCCTCTGG - Intronic
977963037 4:103107497-103107519 GTTGCATAACAGGGTACCTCTGG + Intronic
979370687 4:119882243-119882265 GTGGCATAGCTTGGTAACTCTGG + Intergenic
980467823 4:133208237-133208259 GCAGCTTAACTGGGTGCCTCTGG - Intronic
981948076 4:150373210-150373232 GTGGCTTAGCTAGGTGGCTCTGG - Intronic
982546393 4:156738292-156738314 TTGGCTTAGCTACGTAGCTCTGG - Intergenic
983147185 4:164230720-164230742 GTGGCTTAACTGGGTGGTTCTGG - Intronic
986606890 5:9531589-9531611 GAGGCTTTCCTAGGAACCTCAGG - Intronic
988946942 5:36213187-36213209 GTAGCTTAGCTAGTTACTTCTGG - Intronic
992066917 5:73117705-73117727 GTGGCTTAGCTGGGTACTTCTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994069484 5:95583976-95583998 GTGCCTTCACTAAGTTCCTCTGG + Intronic
994079914 5:95697134-95697156 GTGGCTTAGCTAGGTGGTTCTGG + Intronic
995434061 5:112115690-112115712 GTGGCTTAGCTGGGTTCATCTGG - Intergenic
995435989 5:112135851-112135873 GTGGCTTAACTGGGTGCTTCTGG - Intergenic
997620662 5:135290510-135290532 GTGGCTTAACTAGGTACCTCAGG - Intronic
998270596 5:140703046-140703068 GTGGCTTACCTAGGTGGTTCTGG + Intronic
998617868 5:143760837-143760859 GTGGCTTAGCTAGATGCTTCTGG + Intergenic
998700319 5:144691323-144691345 GTGGCTTACTTGGGTATCTCAGG - Intergenic
1002554618 5:180026493-180026515 GTGGTTTCACTTGTTACCTCTGG - Intronic
1009697101 6:67120653-67120675 ATGGCCTAACTTGTTACCTCAGG - Intergenic
1013847454 6:114471256-114471278 GTGGCTTAGCTGGGTGGCTCTGG - Intergenic
1014626405 6:123731235-123731257 GTGGCTTCATTAGGTGGCTCTGG + Intergenic
1015682994 6:135828633-135828655 GTGGCTTGGCTGGGTAGCTCTGG - Intergenic
1020216310 7:6193626-6193648 CTGGCTTCACTACGTAACTCTGG + Intronic
1020630438 7:10632909-10632931 GTGGCTTAGCTGGGTGCCTCTGG + Intergenic
1033507320 7:142018131-142018153 TTGGCTTAGCTAGGTGCCTCTGG + Intronic
1033885300 7:145936975-145936997 ATGCCTTAATTAGGTGCCTCTGG - Intergenic
1036641401 8:10586337-10586359 GTGGCTTAAATGGTTACATCAGG - Intergenic
1037761885 8:21747005-21747027 GTGTCTGAACTAGGCATCTCAGG - Intronic
1038051715 8:23820299-23820321 ATGGCTTAACTAGGGCTCTCAGG - Intergenic
1040940825 8:52830952-52830974 GTGGCTTAGCTGGATGCCTCTGG - Intergenic
1043668258 8:82846136-82846158 ATGCCTTAACCAGGTAACTCAGG - Intergenic
1043969087 8:86510631-86510653 GTGGCTTAGCTGGGTGCTTCTGG - Intronic
1047891289 8:129313984-129314006 GTGGCTTTGCTGGGCACCTCTGG - Intergenic
1048196011 8:132332330-132332352 ATGGCTTATCTGGGTACCTCTGG - Intronic
1055744984 9:79433739-79433761 GAGGCTTAACTAGGTGTTTCTGG + Intergenic
1056445769 9:86665144-86665166 ATGGCTTAACTAAGTGCGTCAGG + Intergenic
1057958488 9:99432195-99432217 GTGGCTTAGTTAGGTGCTTCTGG + Intergenic
1058849301 9:108995044-108995066 GTGGCTTCACTGGGTGGCTCAGG - Intronic
1060127244 9:121059937-121059959 ATGGCTTAGCTAGGTAATTCTGG - Intergenic
1060676402 9:125519228-125519250 GTAGCTTGACTATGGACCTCAGG - Intronic
1062712212 9:137982154-137982176 GTGGCTTAACTGGGTGCACCTGG + Intronic
1189506988 X:41621598-41621620 GTGGCTTAGCTGTGTGCCTCTGG - Intronic
1189562847 X:42208765-42208787 GTGGCTCAACTAAGCACCTCTGG + Intergenic
1190288360 X:48975238-48975260 CTGGCTTCACTAGGTCTCTCAGG + Exonic
1195152596 X:102087264-102087286 GTGGCTTACCTGGGTGCCTCTGG - Intergenic
1195467146 X:105191973-105191995 CTTGCTTAAATAGGTACCACTGG + Intronic
1198502100 X:137260401-137260423 GTGGCTTAGGTAGGTCCCTCTGG + Intergenic
1200021596 X:153215335-153215357 GTGGCTTAGTTGGGTGCCTCTGG - Intergenic