ID: 997622746

View in Genome Browser
Species Human (GRCh38)
Location 5:135309469-135309491
Sequence TGTGCTCTTTGGATCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997622739_997622746 15 Left 997622739 5:135309431-135309453 CCCTTCTCTTGTACTATACACTT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG 0: 1
1: 1
2: 0
3: 18
4: 149
997622738_997622746 16 Left 997622738 5:135309430-135309452 CCCCTTCTCTTGTACTATACACT 0: 1
1: 0
2: 2
3: 22
4: 166
Right 997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG 0: 1
1: 1
2: 0
3: 18
4: 149
997622740_997622746 14 Left 997622740 5:135309432-135309454 CCTTCTCTTGTACTATACACTTA 0: 1
1: 0
2: 1
3: 6
4: 179
Right 997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG 0: 1
1: 1
2: 0
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997622746 Original CRISPR TGTGCTCTTTGGATCAGAGG GGG Intronic
901465229 1:9417037-9417059 TGTCCTGGTTGGATCAGAGAGGG + Intergenic
901957701 1:12798250-12798272 TGTGCTCATTGGGTCATAGGTGG - Intergenic
902754186 1:18538195-18538217 TGAGCTCTCTGGAGCAGAGAAGG - Intergenic
903830303 1:26170451-26170473 TGTGGTCTTTGGATCGGAAGTGG - Exonic
904267742 1:29327242-29327264 AGTCCTGTTTGGATCAGATGAGG + Intergenic
906522979 1:46478112-46478134 TGTGCTAATTGGCACAGAGGAGG + Intergenic
906645446 1:47471256-47471278 TCTGCTCTGTGGCTCAGAGGAGG - Intergenic
907281715 1:53351356-53351378 TGTGCTCTTTTTAGCACAGGAGG - Intergenic
908072957 1:60483721-60483743 TGTGCTCTGGGAATCAGAGAAGG - Intergenic
910314627 1:85868331-85868353 TTTCCTCTTTGGATCTTAGGAGG + Intronic
911699163 1:100931035-100931057 TGTGTTCATTGGTTCAGATGAGG + Intronic
913127270 1:115804222-115804244 TGCCCTCTTTGGAGCTGAGGAGG - Intergenic
916921440 1:169471914-169471936 TGTGCTGTTTAGCCCAGAGGGGG + Intronic
919609319 1:199725663-199725685 TGTGCTCTTTGCCTCAGGGAAGG + Intergenic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
924003648 1:239582543-239582565 TGTCCTGTATGGAGCAGAGGAGG - Intronic
924576471 1:245285189-245285211 CATGCTCTATGGATCTGAGGAGG - Intronic
1064559309 10:16580284-16580306 TATGATCTTTGTATAAGAGGAGG + Intergenic
1065113038 10:22458755-22458777 TGTGCTCTATGGTTTAGAGAGGG + Intergenic
1066125510 10:32337975-32337997 TGTGCTCTGGGACTCAGAGGAGG - Intronic
1067439766 10:46301971-46301993 TGTGGTCTTTGGGTCAGGGCAGG + Intronic
1067808815 10:49411125-49411147 TGTGTTCTTTGGATCTGACTGGG - Intergenic
1070379306 10:75866252-75866274 TGTGCTGTGTGGAGCAGAGGTGG - Intronic
1072063351 10:91839262-91839284 TGTGCTCTTTGGTTCAGAGGAGG - Intronic
1072723705 10:97797997-97798019 TGTTCTCTGTGGACCAGATGAGG + Intergenic
1076601948 10:131663065-131663087 TCTGCTCTGTGGGTCTGAGGGGG - Intergenic
1077669613 11:4145604-4145626 TGTGGTCTTTGGGTCAGACTGGG + Intergenic
1078392770 11:10951312-10951334 TGTGATCTTTGGAGGAGAAGAGG + Intergenic
1078881021 11:15448793-15448815 TGTACTGGCTGGATCAGAGGAGG + Intergenic
1080569722 11:33544959-33544981 TGTCCTCTTTGGGCCAGATGCGG - Exonic
1081474629 11:43414824-43414846 TGTGTTCTTTTGATCAGAAGAGG - Intronic
1081735421 11:45400154-45400176 TTTGATCTTTGGATCAGAAGAGG - Intergenic
1082100347 11:48168016-48168038 TGTTCTCATTTGATCAGGGGAGG + Exonic
1083762805 11:64827816-64827838 TGTTCCCTGTGGAACAGAGGGGG - Intronic
1084459936 11:69291132-69291154 GCTGCCCTTTGGCTCAGAGGAGG + Intergenic
1086220441 11:84436992-84437014 TGTGATCTTTGGTTCTGAAGTGG - Intronic
1086424061 11:86666888-86666910 TGTCTTCTTTGGATGAGGGGAGG - Intronic
1089138395 11:116267451-116267473 TGAGCTCTTTAGACCAGTGGGGG - Intergenic
1090444012 11:126748058-126748080 TCTGCTCCTTGAATCTGAGGAGG + Intronic
1092751630 12:11724608-11724630 TGTGCTCTGTGTATCAGAAGAGG + Intronic
1094090376 12:26643132-26643154 TCTGCTTTTTGGATCACAGATGG - Intronic
1099550915 12:84042809-84042831 TGTGATCTTTGGAGGAGAAGAGG + Intergenic
1102760416 12:115380299-115380321 TGGGCTCTCTGGGACAGAGGTGG + Intergenic
1104055212 12:125224867-125224889 TGTGGTCTTGGGATCAGGGAAGG - Intronic
1104692503 12:130837959-130837981 TGTGTTCTGTGGTTCAGATGAGG - Intronic
1106278402 13:28238219-28238241 TGTACTCTTTGGTTCAAATGAGG - Intronic
1107564053 13:41583797-41583819 TGTGAACTTTGGATCCTAGGTGG + Intronic
1107604780 13:42047515-42047537 TGTTCTCTTTGGATGACAAGAGG + Intronic
1108184004 13:47870596-47870618 TGTGGTCTTTGGACCAGCGGTGG - Intergenic
1108544454 13:51478510-51478532 TGTGGTCTGTGGAACAGAGAGGG + Intergenic
1112268001 13:97942990-97943012 CGTGCTCTTTTGAGCAAAGGTGG + Intergenic
1112458126 13:99580199-99580221 TGTGCTCTTTGAATGTGAGATGG - Intergenic
1116484203 14:45427422-45427444 TGGGCTCATTGCTTCAGAGGAGG + Intergenic
1120680856 14:87479047-87479069 TGTCCATTTAGGATCAGAGGAGG - Intergenic
1121731719 14:96192233-96192255 TGTGCCCTTTGGATCCCATGAGG - Intergenic
1122065656 14:99172690-99172712 TCTTCTCTTTGGCCCAGAGGTGG - Exonic
1123028555 14:105439898-105439920 GGGGTTCTTGGGATCAGAGGGGG + Intronic
1124360930 15:29036038-29036060 TGTGCCCTTTGGCTCAGGGCTGG + Intronic
1125291060 15:38147345-38147367 TGTCCTCTTTGGATGTGAGGAGG - Intergenic
1126811269 15:52407460-52407482 TGTCCACTCTGAATCAGAGGTGG + Intronic
1127186210 15:56483485-56483507 TGTGTTCTGTGGCTCAGAGGTGG - Intergenic
1128246746 15:66138170-66138192 TGTGCCCTAAGGAGCAGAGGGGG - Intronic
1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG + Intronic
1129605407 15:77022670-77022692 TCAGCTCTGTGGATGAGAGGAGG - Intronic
1129622914 15:77165599-77165621 TCTGCTCTTTGAGTCAGAGTAGG + Intronic
1129953758 15:79614684-79614706 GGAGATCTTTGGATAAGAGGGGG + Intergenic
1131290000 15:91099344-91099366 TGTGCTCCATGGAGAAGAGGGGG + Intergenic
1133371794 16:5250893-5250915 TGGGCTGTCTGGATCAGAGGGGG + Intergenic
1135081400 16:19439216-19439238 TGTGGTCTGTGGATCAGAGCTGG + Intronic
1140574974 16:76157088-76157110 TGTGCTCCTTGGATGACAGAAGG + Intergenic
1141290446 16:82713699-82713721 TGTGCTCTTTGAATATTAGGTGG + Intronic
1143811464 17:9475128-9475150 TGTGCTCTTTGGAATGAAGGAGG - Intronic
1145951324 17:28820603-28820625 TTTGCTTTTTGGTTCAGATGAGG - Intronic
1146665844 17:34702805-34702827 TGTGCTGAATGGATCAGGGGAGG + Intergenic
1147472087 17:40671957-40671979 TGTGCTCATTGTCTCAGGGGAGG - Intergenic
1148744041 17:49908547-49908569 TGTGGGCTTTGGCTTAGAGGAGG + Intergenic
1149361267 17:55898367-55898389 TGTGCACTTTGAAACAGAGCAGG + Intergenic
1149407793 17:56372316-56372338 TGTACTCTCTGGATGAGAAGTGG + Intronic
1150235908 17:63592579-63592601 TGTTTTCTTTATATCAGAGGAGG + Exonic
1151415263 17:73957910-73957932 TGTACTTTTTGGATCAGGGTGGG - Intergenic
1155116998 18:22778556-22778578 TGTGTTCTATGGATCAGGTGTGG - Intergenic
1155154854 18:23149673-23149695 TGTGCTCTCTGGACCAGCGGCGG + Intronic
1156072697 18:33231953-33231975 TGTGTTCTTTAGAACAGAGATGG + Intronic
1156824868 18:41418885-41418907 GGTGCTCTATGGCTCAGAGGTGG - Intergenic
1157188277 18:45559116-45559138 TGTGCTAGGTGGATTAGAGGGGG + Intronic
1159123962 18:64201542-64201564 TGTCCTCAGTGGCTCAGAGGAGG + Intergenic
1161319208 19:3633283-3633305 TGGGCTCTCTGGCTCTGAGGTGG - Intronic
1165297670 19:34940871-34940893 TGGGCTCTTTGGATTAGGGATGG - Intronic
926303403 2:11619423-11619445 TCTGCTCTTTGGAACAGAGCTGG + Intronic
926605844 2:14897822-14897844 TGTGGTCTTTGGAAGTGAGGAGG + Intergenic
926701440 2:15806802-15806824 TGTGCTCTTGAGCACAGAGGAGG + Intergenic
927845940 2:26473018-26473040 TTTGCTCTTTGGGGCCGAGGGGG - Intronic
935262674 2:101368812-101368834 CCTGCTCTCTGGTTCAGAGGTGG - Intronic
935572208 2:104673646-104673668 TGTGCTGTTTAGAGAAGAGGGGG - Intergenic
938791723 2:134682081-134682103 TGTGCTCTGTAGGTCAGATGAGG - Intronic
943506538 2:188767661-188767683 TGTGCTCTGAGAATCAGAGTTGG + Intronic
944169312 2:196757673-196757695 TGTGATCCTTGGAGGAGAGGAGG + Intronic
944707969 2:202310022-202310044 GGGGCTGTTTAGATCAGAGGTGG + Intergenic
946796455 2:223359455-223359477 TTTGCTCTTTGGATTTAAGGAGG - Intergenic
947167664 2:227278902-227278924 TGTGATCTCTGGTTCAGAAGAGG - Intronic
947713985 2:232330798-232330820 TGTGCTCCTGGGAGCAGGGGAGG - Intronic
948418289 2:237833709-237833731 TGTGTTCTATGGTTCAGATGAGG + Intronic
1168737792 20:158375-158397 TGTTCTCTGGGCATCAGAGGAGG + Intronic
1168807606 20:681654-681676 TCTTTTCTTTGGCTCAGAGGAGG - Intergenic
1172494528 20:35369986-35370008 AGAGCACTTTGGAGCAGAGGTGG - Intronic
1174571822 20:51507510-51507532 TGTGATCTTTGGCACAGAGAAGG - Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179975494 21:44863390-44863412 TGTGCTCTTGGGCACACAGGAGG - Intronic
1181102684 22:20551980-20552002 TGGGCCCTCTGAATCAGAGGAGG - Intronic
1181562070 22:23710953-23710975 TGTAGTCTTTGGATGAGTGGAGG - Intergenic
1184702624 22:46186774-46186796 TATCCTCTTTGGATAAGGGGGGG - Intronic
951097607 3:18650048-18650070 TCTTCTCTTTGGCTCAGAGAGGG + Intergenic
952206605 3:31186647-31186669 TGTGCTGTCTAGATCAGTGGTGG - Intergenic
952712870 3:36449145-36449167 TAGGCTCTGTGGATTAGAGGAGG + Intronic
954816927 3:53289849-53289871 TGTGCTCTTTGTAAATGAGGAGG - Intronic
956381209 3:68666376-68666398 TGAGCTAATTGGACCAGAGGTGG - Intergenic
962705873 3:138044041-138044063 AGAGCTGATTGGATCAGAGGTGG - Intergenic
963038917 3:141054540-141054562 TGTGCCCTTTGGGAAAGAGGTGG + Intronic
970165163 4:13228946-13228968 TGTGATCTTTGGACGAGAGATGG - Intergenic
970846624 4:20546302-20546324 TGTGCTTTTTTGAATAGAGGAGG - Intronic
972283873 4:37629949-37629971 GGTGCTCTTTGCCTCAGGGGCGG - Intronic
977546910 4:98394353-98394375 TATGCTCTTTTCATAAGAGGCGG - Intronic
977867107 4:102042450-102042472 TGTGCTCTTTTAAACAGAAGAGG - Intronic
978496576 4:109365931-109365953 TGTGGTCTTGGGAGGAGAGGAGG + Intergenic
980311549 4:131136929-131136951 TGAGCTCTTTGGCTGAGTGGAGG - Intergenic
982151212 4:152459609-152459631 TATGCTCTGTGGATAAGTGGGGG - Intronic
983509182 4:168589220-168589242 TGTTCTCATTAGATCAGACGTGG - Intronic
984457408 4:179987657-179987679 TGTGTTCTTTGGAGGAGAAGAGG - Intergenic
984707259 4:182856524-182856546 TGTTCCCTTTCGAGCAGAGGAGG - Intergenic
985992327 5:3573849-3573871 TGTGGTCTCTGCATCACAGGTGG + Intergenic
986405734 5:7423254-7423276 CTGGCTCTTTGGAGCAGAGGAGG + Intronic
996877856 5:128259742-128259764 TGTGCTCCTTAGAGCCGAGGTGG + Exonic
996884534 5:128339839-128339861 TGTGCTCTCTGGCTCAGGGTTGG - Intronic
997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG + Intronic
997654722 5:135546370-135546392 TGTGCACTTTGCATCTGAAGTGG + Intergenic
999708745 5:154297481-154297503 TGTGCTGTGGGTATCAGAGGAGG + Intronic
1003235010 6:4287914-4287936 TGAGCGCTGTGGCTCAGAGGAGG - Intergenic
1005785728 6:29244022-29244044 TGTGATCTTTGGAGTAGAAGAGG + Intergenic
1006263632 6:32896942-32896964 GCTGCTGCTTGGATCAGAGGAGG + Intergenic
1007737660 6:43991641-43991663 TGAGCTCTCTGGGTAAGAGGTGG - Intergenic
1010812594 6:80317069-80317091 TGAGCTGTCTGGATCAGATGTGG + Intronic
1011217417 6:85019623-85019645 TTTGCCCTTTGGTTCTGAGGGGG - Intergenic
1013400831 6:109794646-109794668 TCTCCCCTTTGGATCAGAGGAGG - Intronic
1017977802 6:159373592-159373614 TGTGCTCCTGGGACCAGAGGTGG - Intergenic
1019310752 7:359550-359572 TTTGCTCTTAGGATGAGATGCGG + Intergenic
1019955661 7:4412409-4412431 GATGCTGTTTGGAGCAGAGGTGG - Intergenic
1028326627 7:89534846-89534868 TGTACTCTGTGGATCAAAGCTGG - Intergenic
1028487631 7:91377388-91377410 TGTGTTCTCTGCATCACAGGAGG + Intergenic
1038661381 8:29500057-29500079 AGTGCTCTTTGGCTAAGAGCGGG + Intergenic
1038871170 8:31495337-31495359 TAAGCTCTTTGGCTCGGAGGTGG + Intergenic
1042503472 8:69535429-69535451 TGTGCTCTATGGGAGAGAGGAGG + Intronic
1044527857 8:93272010-93272032 TCTGCTCTCTGGATCAGATATGG + Intergenic
1044689549 8:94863072-94863094 TCTGCCCCTTGGATCAGAGTGGG + Intronic
1045883082 8:107064322-107064344 TGTGATCTTTGGAGGAGAAGAGG + Intergenic
1047829955 8:128618276-128618298 TCTAGTCTTTGGATGAGAGGAGG + Intergenic
1053380061 9:37641569-37641591 CCTGTTCTTTGAATCAGAGGGGG - Intronic
1053470359 9:38341942-38341964 TGTGATCCATGGATCTGAGGAGG - Intergenic
1055917487 9:81420646-81420668 TCTGCACTTGGGATGAGAGGTGG - Intergenic
1056690477 9:88804106-88804128 TGTGCTGGCTGGATCAGGGGAGG + Intergenic
1057636506 9:96774213-96774235 TAGGCTCTGTTGATCAGAGGTGG - Intronic
1060003935 9:119982914-119982936 AGTGCTCTGTGGGTCAGATGAGG + Intergenic
1060921365 9:127422836-127422858 AGTGCTTTTTGGATCACTGGGGG - Intergenic
1060940083 9:127538150-127538172 GGTGCTCTGTGGATCTCAGGGGG + Intronic
1188939902 X:36224680-36224702 TGTGGTCTTTGGATCTCAGCTGG - Intergenic
1189080326 X:37964217-37964239 TCTGCTCTCTGGATCATAGATGG - Intronic
1191137659 X:57083073-57083095 GGTGCTCTGTGGGTCAGGGGAGG - Intergenic
1198082867 X:133255446-133255468 GGTGCTCTTCTCATCAGAGGAGG - Intergenic
1198481815 X:137048122-137048144 TGGGCTGTTTGGATCAGAAATGG + Intergenic
1199922888 X:152428321-152428343 GTAGCTCTTTGGATGAGAGGAGG - Intronic