ID: 997624967

View in Genome Browser
Species Human (GRCh38)
Location 5:135325273-135325295
Sequence GCCCCTTGCAGGCCTGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1258
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 1215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997624956_997624967 24 Left 997624956 5:135325226-135325248 CCCTCTAGAAACTGGGGATGGTT 0: 1
1: 0
2: 0
3: 19
4: 199
Right 997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG 0: 1
1: 0
2: 0
3: 42
4: 1215
997624962_997624967 -6 Left 997624962 5:135325256-135325278 CCAGACTAGCCTCATTGGCCCCT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG 0: 1
1: 0
2: 0
3: 42
4: 1215
997624957_997624967 23 Left 997624957 5:135325227-135325249 CCTCTAGAAACTGGGGATGGTTG 0: 1
1: 0
2: 2
3: 9
4: 185
Right 997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG 0: 1
1: 0
2: 0
3: 42
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997624967 Original CRISPR GCCCCTTGCAGGCCTGGCTA GGG Intronic
900113329 1:1018733-1018755 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
900403013 1:2480341-2480363 CCCCCGTGCAGCCCTGGCTCTGG - Intronic
901046030 1:6396150-6396172 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
901190703 1:7408204-7408226 GCCCCCGGCAAGCCTGGCGATGG + Intronic
901601531 1:10426781-10426803 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
901656814 1:10774099-10774121 GCCCCTTGTGGGCCTGGCGGTGG - Intronic
901783288 1:11608696-11608718 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
902048633 1:13544358-13544380 GCGACTTGCAGCCCTGGCTAAGG + Intergenic
902100480 1:13983584-13983606 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
902242688 1:15099508-15099530 GCCCCTTGCAACCCTGCCCAGGG - Intronic
902803935 1:18849271-18849293 GGCCCTTGCTGGAGTGGCTAGGG - Exonic
902990859 1:20186191-20186213 GCCCCTTCCAGGCCTGGCGGAGG - Intronic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903559155 1:24215002-24215024 GCCCCTTGCAGGTGAGGCTCAGG + Intergenic
903920674 1:26798015-26798037 GCCCCTTCTGGTCCTGGCTAGGG + Exonic
903926432 1:26833963-26833985 GGCCCTCGCAGGCGTGGCTGAGG - Intronic
904238933 1:29131499-29131521 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
904370093 1:30042799-30042821 GCCCTTTCCAGGCCTGCCCATGG + Intergenic
904906710 1:33902725-33902747 GCCACATGCAGGACTGGCTCTGG + Intronic
905029009 1:34869004-34869026 GGGCCTGGCAGGCCTGGCCACGG - Exonic
905375574 1:37518190-37518212 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
905839463 1:41162444-41162466 GCCTTTTCCAGGCCTGCCTATGG + Intronic
906286516 1:44591377-44591399 TGCCCTTGCAGGCCTTGCTAAGG + Intronic
906563566 1:46778927-46778949 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
907243498 1:53093277-53093299 GCCCCAGCCAGGCCTGGCTCCGG - Intronic
907411487 1:54286767-54286789 GCGCCTTGGAAGCCAGGCTAAGG + Intronic
907889436 1:58623370-58623392 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
907980003 1:59472067-59472089 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
908259325 1:62327439-62327461 GCCTCTTCCAGGCCTGCCCATGG - Intergenic
908291279 1:62669828-62669850 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
908888534 1:68817658-68817680 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
909377129 1:74952469-74952491 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
909904622 1:81179033-81179055 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
910376769 1:86581174-86581196 GCCTCTGGCTGACCTGGCTATGG - Intergenic
910685759 1:89914380-89914402 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
910693190 1:89985039-89985061 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
911001401 1:93170207-93170229 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
911305286 1:96224761-96224783 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
911657508 1:100461595-100461617 GGCCTTTGCAGGCCTTGCAATGG - Intronic
911954549 1:104217866-104217888 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
912058183 1:105631657-105631679 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
912166093 1:107044694-107044716 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
912315873 1:108667415-108667437 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
913161119 1:116146977-116146999 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
913468957 1:119171486-119171508 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
913470144 1:119179005-119179027 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
913485255 1:119327731-119327753 GCTGTTTGCAGGCCCGGCTAGGG - Intergenic
913486065 1:119333692-119333714 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
913692169 1:121289526-121289548 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
914145386 1:144990588-144990610 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
914203486 1:145506274-145506296 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
914244068 1:145872938-145872960 GGCCCTAGGAGGCCTGGCAAAGG - Exonic
914438496 1:147681188-147681210 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
914482608 1:148079428-148079450 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
915104071 1:153521725-153521747 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
915259994 1:154670689-154670711 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
915666166 1:157446702-157446724 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
915764543 1:158349402-158349424 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
915767210 1:158374546-158374568 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
916762866 1:167832887-167832909 GCCCCCTGGAGGCCAGGCTTTGG + Intronic
916938984 1:169661155-169661177 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
917406274 1:174711259-174711281 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
917445462 1:175102722-175102744 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
917446417 1:175108879-175108901 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
917578604 1:176349692-176349714 GCCCCTTTCTGGGCTGGCTAAGG - Intergenic
917860459 1:179138778-179138800 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
918659814 1:187074238-187074260 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
918732353 1:188013722-188013744 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
918792098 1:188841596-188841618 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
918853265 1:189718719-189718741 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
918993836 1:191731753-191731775 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
919049841 1:192499482-192499504 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
919091844 1:192986850-192986872 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
919117985 1:193305116-193305138 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
919168009 1:193919334-193919356 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
919174415 1:194001780-194001802 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
919236983 1:194859005-194859027 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
919377106 1:196808737-196808759 GCCCCTTTCTGGGCTGGCTGAGG + Intergenic
919386811 1:196933637-196933659 GCCCCTTTCTGGGCTGGCTGAGG + Intronic
919420410 1:197363753-197363775 GCCCTTTCCATGCCTGGCAACGG + Intronic
919630905 1:199959612-199959634 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
919982503 1:202651028-202651050 GGGCCTTGCAAGCCAGGCTAAGG + Intronic
920479493 1:206307874-206307896 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
920731424 1:208488860-208488882 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
920756626 1:208739619-208739641 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
920883204 1:209899222-209899244 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
921897042 1:220412370-220412392 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
921903903 1:220476116-220476138 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
922485369 1:225969708-225969730 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
922541968 1:226426712-226426734 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
922808995 1:228405790-228405812 GCTCCTTGCTGGCCAGGGTATGG + Intronic
922855736 1:228773644-228773666 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
923157289 1:231289897-231289919 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
923172652 1:231431195-231431217 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
923324866 1:232871865-232871887 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
923623280 1:235594803-235594825 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
923930135 1:238685052-238685074 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
924117463 1:240762429-240762451 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
924219292 1:241855999-241856021 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1063309351 10:4937802-4937824 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1063318789 10:5032939-5032961 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1063321093 10:5053521-5053543 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1063322225 10:5061063-5061085 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1063769637 10:9183288-9183310 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1064277335 10:13918186-13918208 GTTTCTTGCAGGCCTGGCTTTGG + Intronic
1064418388 10:15169098-15169120 GCCCTGTGCAGGGCTGGCCAGGG - Intergenic
1064764634 10:18658942-18658964 ACCCCTAGCACGCCTGCCTAGGG + Intergenic
1064989193 10:21241321-21241343 GCCCCCTGGTGGCCTGGCTCAGG - Intergenic
1065743330 10:28816096-28816118 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1065802553 10:29366133-29366155 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1065895841 10:30162793-30162815 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1065995446 10:31055763-31055785 GCCCCTTTCTGGTCTGGCCAAGG + Intergenic
1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG + Intergenic
1066186244 10:33013230-33013252 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1066190205 10:33049164-33049186 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1066235524 10:33480886-33480908 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1066293568 10:34035333-34035355 GCCCCTTTCTGGGCTGGCTGAGG + Intergenic
1066544296 10:36482418-36482440 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1066660849 10:37737314-37737336 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1067473135 10:46550214-46550236 GGCCCCTGCAGGCCTGGAAAGGG - Exonic
1068373965 10:56155061-56155083 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1069186579 10:65429838-65429860 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1069215401 10:65812475-65812497 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1069766088 10:70861582-70861604 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1069988621 10:72300547-72300569 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1070695693 10:78561559-78561581 GCCCCCAGCAGGGCTGGCCAAGG + Intergenic
1070820418 10:79350916-79350938 GCCCCATGCAGGTTTGGCCACGG + Intronic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070891521 10:79945112-79945134 GCACATTCCAGGCCTGGCTTTGG - Intronic
1070897450 10:79996714-79996736 GCCCCATGCAAGCCTGGGAATGG - Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1070968259 10:80543207-80543229 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1070973331 10:80585816-80585838 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1071003699 10:80859174-80859196 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1071085409 10:81863099-81863121 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1071387950 10:85141338-85141360 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1071797117 10:89018997-89019019 GCCCCTTTCTGGGCTGGCGAAGG - Intergenic
1071901040 10:90120197-90120219 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1073789824 10:106928515-106928537 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1073878260 10:107950518-107950540 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1074190023 10:111127608-111127630 GCCCCCTGCAGACATGGCCAGGG + Intergenic
1074732424 10:116393343-116393365 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1074896842 10:117784610-117784632 TCCTCTTGCAGGCCTGGGGAAGG - Intergenic
1074982421 10:118630475-118630497 GCTCCTTGCAGGAATGGCTCTGG - Intergenic
1074999177 10:118782841-118782863 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1075305665 10:121365516-121365538 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1075537585 10:123283774-123283796 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1075590192 10:123685471-123685493 GCCCCCTCCAGGCCCGGCTGTGG - Intronic
1075883481 10:125875789-125875811 GCCCACTGCAGGAATGGCTAAGG - Intronic
1076277878 10:129220223-129220245 TCCTCTTGCAGGCCTGGGGAAGG - Intergenic
1076670401 10:132117793-132117815 GCCCCGTGCGGGCCTGACTGTGG - Intronic
1076773558 10:132680600-132680622 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1076796590 10:132801358-132801380 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1077603197 11:3588666-3588688 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1077764536 11:5144353-5144375 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1077805706 11:5589818-5589840 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1077815558 11:5682886-5682908 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1077894303 11:6442411-6442433 GGCCCTTTCAGCCTTGGCTAGGG - Intronic
1078251953 11:9623459-9623481 GCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1078301258 11:10133726-10133748 GCCCCTTTCTGGCCTGGCCAAGG - Intronic
1078743746 11:14091749-14091771 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1079191034 11:18276514-18276536 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1079767839 11:24416442-24416464 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1080106078 11:28512753-28512775 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1080138807 11:28890681-28890703 GCCCCTTTCTGGGCTGGCTAAGG + Intergenic
1080503140 11:32888590-32888612 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1080557748 11:33432165-33432187 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1080621388 11:33990038-33990060 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1081115388 11:39192977-39192999 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1081125008 11:39311767-39311789 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1081126991 11:39333489-39333511 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1081329768 11:41788648-41788670 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1081420840 11:42873858-42873880 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1081428325 11:42949815-42949837 GCCCCTTTCCGGGCTGGCCAAGG + Intergenic
1081670483 11:44939544-44939566 GCCTCTGGCAGCCCTGGCTGGGG - Intronic
1082272060 11:50183211-50183233 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1083074348 11:60020638-60020660 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1083546056 11:63550144-63550166 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1084024804 11:66441155-66441177 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1084107354 11:66988744-66988766 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1084186595 11:67476031-67476053 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1084259086 11:67963208-67963230 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1084406131 11:68974662-68974684 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1085245548 11:75098146-75098168 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1085375828 11:76060503-76060525 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1085510949 11:77087960-77087982 GCCCCTCACAGGCCTGGCTGGGG + Intronic
1085519749 11:77130981-77131003 GGCCCTTCCTGGCCTGGCTTTGG - Intronic
1085671134 11:78465324-78465346 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1085857791 11:80195682-80195704 CCCTCTTGCTGGCCTAGCTAAGG - Intergenic
1086042977 11:82501098-82501120 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1086724592 11:90167130-90167152 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1086933841 11:92722830-92722852 GCCCCTTTCAGCCATGGCTAGGG + Intronic
1087354485 11:97076539-97076561 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1087966616 11:104422851-104422873 GCCCCTTCCTGGGCTGGCTGAGG - Intergenic
1088481765 11:110301328-110301350 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1088570821 11:111221917-111221939 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1089185508 11:116612097-116612119 TCCCCTCTCAGCCCTGGCTAAGG - Intergenic
1089466457 11:118689395-118689417 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1089781762 11:120878111-120878133 GTCCCTTGCTGGCCTGGGTTGGG - Intronic
1089800183 11:121021598-121021620 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1089823178 11:121246675-121246697 GCCTCTTCCAGGCCTGCCCATGG + Intergenic
1090133611 11:124171119-124171141 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1090229169 11:125089436-125089458 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1090307739 11:125705124-125705146 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1090588204 11:128237029-128237051 GCCCCTTTCTGGGCTGGCAAAGG + Intergenic
1090776778 11:129972242-129972264 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1090782669 11:130021611-130021633 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1090807303 11:130210495-130210517 GCCCCTTGCTGGCCTAGAGAAGG - Intergenic
1091037219 11:132245127-132245149 GCCCCTGCCAGGCCTGGCAGAGG + Intronic
1091233513 11:134003284-134003306 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1091402298 12:188496-188518 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1091590133 12:1837819-1837841 GCCCCTCTCAGGCCTGGCACAGG + Intronic
1092133907 12:6132556-6132578 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1092142162 12:6191292-6191314 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1092220239 12:6708244-6708266 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1092221341 12:6715975-6715997 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1092272872 12:7037364-7037386 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1092336619 12:7639779-7639801 GCCCCTTTCTGGGCTGGCGAAGG + Intergenic
1092430405 12:8404214-8404236 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1092472906 12:8794662-8794684 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1092545911 12:9450806-9450828 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1092572484 12:9739999-9740021 GCCCCTTGCTGGGCTGGCCAAGG - Intergenic
1092583865 12:9876462-9876484 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1092617212 12:10226053-10226075 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1092732414 12:11547231-11547253 GCCCCTTGCTGGGCTGGCCAAGG + Intergenic
1093172306 12:15874568-15874590 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1093346215 12:18040193-18040215 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
1093381507 12:18500086-18500108 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1093524830 12:20093685-20093707 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1093527144 12:20115651-20115673 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1093581067 12:20784202-20784224 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1093652495 12:21661469-21661491 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1093653992 12:21674472-21674494 GCCCCTTTCTGGCCTGGCCAAGG - Intronic
1093793662 12:23285884-23285906 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1093970161 12:25369312-25369334 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1093972902 12:25391367-25391389 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1094327506 12:29256582-29256604 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1094338668 12:29386662-29386684 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1094405412 12:30110870-30110892 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1094409780 12:30156810-30156832 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1094507045 12:31071267-31071289 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1094589361 12:31806210-31806232 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1094661224 12:32472230-32472252 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1094666430 12:32525612-32525634 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1095123042 12:38441891-38441913 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1095304104 12:40620619-40620641 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1095478658 12:42611199-42611221 GCCCCTTTCTGGGCTGGCAAGGG - Intergenic
1095533922 12:43224261-43224283 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1095901486 12:47333323-47333345 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1097017982 12:56000565-56000587 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1097128994 12:56796261-56796283 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1097981957 12:65744298-65744320 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1098588613 12:72184979-72185001 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1099443788 12:82728710-82728732 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1099523984 12:83696708-83696730 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1099559673 12:84155542-84155564 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1099716282 12:86296814-86296836 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1099790657 12:87330154-87330176 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1099859461 12:88208959-88208981 GCCACCTGCAGGCCTGGAGATGG + Intergenic
1100521410 12:95379547-95379569 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1100600587 12:96108843-96108865 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1100734677 12:97513159-97513181 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1101008931 12:100430240-100430262 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1101021569 12:100559320-100559342 GCCCCTTTCAGGGCTGGCCAAGG + Intronic
1101462020 12:104905934-104905956 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1102387293 12:112520311-112520333 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1102543991 12:113641579-113641601 ACCCCCAGCAGGCCTGGCTGGGG - Intergenic
1102903969 12:116660664-116660686 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1103146204 12:118597597-118597619 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1103402712 12:120654290-120654312 GCCCCTTCCAGGCCTAGAGAGGG - Intronic
1103439292 12:120950765-120950787 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1103678770 12:122677019-122677041 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1103783456 12:123414535-123414557 GCCCCTTTCTGGGCTGGCCAAGG - Exonic
1103853233 12:123946884-123946906 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1103934134 12:124466366-124466388 CCCCCTTGCAGCCCGGGCCACGG + Intronic
1104344435 12:127983320-127983342 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
1104582581 12:130021993-130022015 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1104614577 12:130257076-130257098 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1104749177 12:131227750-131227772 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1105037694 12:132938692-132938714 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1105425588 13:20292355-20292377 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1105697275 13:22900826-22900848 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1106048161 13:26165146-26165168 GCCCCTTTCAGCCATGGCTGGGG - Intronic
1106221386 13:27748736-27748758 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1106600606 13:31183430-31183452 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1106810891 13:33357919-33357941 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1107259438 13:38472852-38472874 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1107590521 13:41899001-41899023 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1107836053 13:44413514-44413536 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1108099235 13:46936476-46936498 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1108435284 13:50396533-50396555 GCCCCTTTCTGGACTGGCCAAGG + Intronic
1108668094 13:52652653-52652675 GCCCCTCGCAGCCATGGTTACGG - Intergenic
1108685517 13:52815638-52815660 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1108751588 13:53452814-53452836 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1108851668 13:54737698-54737720 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1108995956 13:56735548-56735570 GCCCCTTTCCGGGCTGGCCAAGG + Intergenic
1109124754 13:58504648-58504670 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1109140987 13:58714022-58714044 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1109159929 13:58958604-58958626 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1109438969 13:62343958-62343980 GCCCCTTGCTTGCCAGGTTATGG + Intergenic
1109441312 13:62379165-62379187 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1109446666 13:62448320-62448342 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1109563216 13:64077916-64077938 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1109741479 13:66561004-66561026 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1109745759 13:66621887-66621909 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1110368808 13:74718331-74718353 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1110417428 13:75268387-75268409 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1110792451 13:79600580-79600602 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1110862078 13:80355485-80355507 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1110874427 13:80490983-80491005 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1110913986 13:80998849-80998871 GCCCCTTTCTGTGCTGGCTAAGG - Intergenic
1110999898 13:82165372-82165394 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1111138839 13:84086798-84086820 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1111241171 13:85476635-85476657 ACCCTTTGGAGTCCTGGCTATGG + Intergenic
1111590967 13:90348539-90348561 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1111748270 13:92296604-92296626 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1111841473 13:93455207-93455229 GCCCCTTTCTGGTCTGGCCAAGG - Intronic
1112282740 13:98076694-98076716 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1112518584 13:100077454-100077476 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1112533225 13:100224471-100224493 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1112538222 13:100282385-100282407 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1112705802 13:102068413-102068435 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1113191508 13:107753133-107753155 GCTCCTTGCAGCCCTGGGTTTGG + Intronic
1113482742 13:110633451-110633473 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1113506581 13:110821098-110821120 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1113538192 13:111084294-111084316 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1113677999 13:112221655-112221677 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1113948381 13:114057777-114057799 GCCCCTTCCAGGTCTGGGTGTGG - Intronic
1114560369 14:23585304-23585326 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1114593477 14:23891695-23891717 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1116452301 14:45080375-45080397 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
1116623956 14:47242382-47242404 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1116653719 14:47626495-47626517 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1117181938 14:53200367-53200389 GCCCCTTCCAGCCATGGCTGGGG - Intergenic
1117302454 14:54442990-54443012 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1117571982 14:57057037-57057059 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1118215421 14:63803684-63803706 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1118306274 14:64658117-64658139 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1119038781 14:71254234-71254256 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1119300374 14:73566755-73566777 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1119303735 14:73590855-73590877 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1119486723 14:74994095-74994117 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1119673507 14:76537172-76537194 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1119870754 14:78014403-78014425 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1120229822 14:81829870-81829892 GCCCCTTCCTGGGCTGGCTGAGG - Intergenic
1121350712 14:93170505-93170527 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1121693880 14:95896828-95896850 TCTCCTTGCAGGCCTGGCTCTGG + Intergenic
1121974054 14:98385908-98385930 GCCTCTTCCAGGCCTGCCCATGG + Intergenic
1122140627 14:99660850-99660872 GCTCCCTGCAGTCCTGGCTGGGG - Intronic
1122298108 14:100716872-100716894 GCTCCTGGCAGGCCTGCCTGAGG + Intergenic
1122493515 14:102135932-102135954 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1122600212 14:102917616-102917638 GGCCCTTTCAGTCCTGGCTGTGG + Intergenic
1122640425 14:103156185-103156207 ACCCCATGCAGGCCTGGGCAGGG + Intergenic
1123118906 14:105908094-105908116 TCCCCTCTCAGGCCTGGCTCTGG - Intergenic
1123949192 15:25253615-25253637 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1124036316 15:26056851-26056873 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1124110650 15:26782047-26782069 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1124114918 15:26831601-26831623 GCCCCTTTCCGGGCTGGCCAAGG - Intronic
1124182682 15:27491383-27491405 GCCCAGTCCAGTCCTGGCTAGGG + Intronic
1124387898 15:29225168-29225190 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1125112156 15:36046892-36046914 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1125480351 15:40075194-40075216 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1125565811 15:40677349-40677371 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1125609643 15:40961556-40961578 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1125631545 15:41151617-41151639 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1126128018 15:45314031-45314053 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1126782309 15:52149403-52149425 TCCCCTTGCAAGTCTGGCTTGGG - Intronic
1126983356 15:54272951-54272973 GCACCTTGCACCCCTGCCTATGG - Intronic
1127766117 15:62186983-62187005 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1127984704 15:64060790-64060812 GCCCCTTCCTGGGCTGGCTGAGG + Intronic
1128110789 15:65074963-65074985 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1128501475 15:68229917-68229939 GTCCCTTGCCTGCCTGGGTACGG + Intronic
1128598628 15:68976090-68976112 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1128670033 15:69567778-69567800 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1128813363 15:70587587-70587609 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1129158320 15:73732567-73732589 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1129196878 15:73973687-73973709 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1129280452 15:74480766-74480788 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1129777557 15:78246560-78246582 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1129859111 15:78846812-78846834 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1129986846 15:79926052-79926074 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1129997096 15:80016461-80016483 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1131012759 15:89032075-89032097 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1131143129 15:89993745-89993767 GCTCCTTGAAGGCCTGGCCTAGG + Intergenic
1131212640 15:90510898-90510920 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1131250206 15:90825460-90825482 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1131507733 15:93031766-93031788 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1131892244 15:96984581-96984603 GCCCCTTTCTGGACTGGCCAAGG - Intergenic
1132044159 15:98549693-98549715 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1132065799 15:98729852-98729874 GCTTCTGGCAGGCCTGGATAAGG + Intronic
1132467329 16:83367-83389 GCCACTTCCAGGCCAGGCCAGGG + Intronic
1132467574 16:84563-84585 GCCCCTTGGATTCCTGGCTGGGG - Intronic
1132510961 16:341205-341227 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1132810304 16:1793928-1793950 GCCCCCTGCAGGGCTGACTGGGG + Intronic
1132836883 16:1958622-1958644 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1133352214 16:5108932-5108954 GTCCCTTCCTGGGCTGGCTAAGG - Intergenic
1133690400 16:8209024-8209046 GCCCCTTGCAGGCTTAGGTTTGG + Intergenic
1134678191 16:16105048-16105070 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1135152415 16:20020345-20020367 TTCCCTTGCAGACCTGGCTGGGG + Intergenic
1135751127 16:25059332-25059354 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1136022525 16:27449106-27449128 ACCCCTGGCCGGCCTGGATATGG + Exonic
1136163242 16:28435308-28435330 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1136199723 16:28679679-28679701 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1136216071 16:28793852-28793874 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1137512006 16:49108918-49108940 CCCCCATGCAGACCTGGCTGTGG - Intergenic
1138656338 16:58493825-58493847 GCCACTTTCAGGCCTGGTGAGGG - Intronic
1139018964 16:62724810-62724832 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1139125598 16:64072749-64072771 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1139442255 16:66974219-66974241 GCCCCTTTCTGGGCTGGCCAAGG + Exonic
1139602992 16:67998154-67998176 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1139676369 16:68526687-68526709 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1139878254 16:70163699-70163721 GACCCTGGCTGGCCAGGCTAAGG - Intergenic
1140359309 16:74331115-74331137 GACCCTGGCTGGCCAGGCTATGG + Intergenic
1141103546 16:81215165-81215187 GTCCCTCGCAGGCCAGGCTCTGG + Intergenic
1141387285 16:83633498-83633520 ACTCCTTTCAGACCTGGCTAAGG - Intronic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1141465794 16:84205003-84205025 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1141703123 16:85651433-85651455 GCACCTTCCTGGCCTGGCTGAGG - Intronic
1142435654 16:90055250-90055272 ACCCCTTGCATGCCTGGATGTGG + Intergenic
1142505611 17:361532-361554 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1142572012 17:880912-880934 GCCCCTTGGAGCCCTGGCCCAGG - Intronic
1143460557 17:7100949-7100971 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1143552696 17:7640836-7640858 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1143664335 17:8347541-8347563 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1143708716 17:8718489-8718511 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1144467094 17:15505636-15505658 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1144723160 17:17486292-17486314 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1144850739 17:18242680-18242702 GCCCCTGGCAGCCCTGGGGACGG - Intronic
1145094786 17:20016404-20016426 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1145825728 17:27875969-27875991 GAGCCCTGCAGGCCTTGCTAAGG - Intronic
1146740525 17:35279335-35279357 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1147314172 17:39611769-39611791 GGGCCTTCCAGGCCTGGCTGAGG - Intergenic
1147373566 17:40010872-40010894 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1147431763 17:40375765-40375787 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1148016810 17:44527904-44527926 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1148366235 17:47057704-47057726 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1149753923 17:59172463-59172485 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1150235991 17:63593072-63593094 GCCCCTTTCATTCCTGGCTTGGG + Exonic
1150775768 17:68080596-68080618 GCCCCTTCCTGGGCTGGCCAAGG + Intergenic
1150778222 17:68099222-68099244 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1150786798 17:68169778-68169800 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1150792189 17:68207796-68207818 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1151118445 17:71765703-71765725 GCCCCTGCCAGACCTGGCAAGGG + Intergenic
1151782735 17:76258070-76258092 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1151866372 17:76806069-76806091 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1151974006 17:77474311-77474333 GGCCCTCTCAGGCCTGCCTATGG - Intronic
1152068134 17:78122547-78122569 GCTCCCTGCAGGCCTGGCCCTGG - Intronic
1152619107 17:81352463-81352485 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1152621281 17:81366127-81366149 GCCCAGGGCAGGCCTGGCTGTGG - Intergenic
1153070322 18:1098165-1098187 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1153644117 18:7179087-7179109 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1153832523 18:8935844-8935866 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1153882664 18:9434535-9434557 CCGCCGTGCAGGCCTGGCTGAGG - Intergenic
1154057303 18:11024067-11024089 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1154318469 18:13325276-13325298 GACACTTGCAGTCGTGGCTATGG + Intronic
1154506283 18:15043778-15043800 GCCCCAAGCTGACCTGGCTATGG + Intergenic
1155208109 18:23578052-23578074 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1155272013 18:24149975-24149997 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1155611768 18:27674284-27674306 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1155772816 18:29723456-29723478 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1155852226 18:30788383-30788405 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1155856433 18:30839579-30839601 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1156038609 18:32794514-32794536 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1156610542 18:38718803-38718825 GCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1156863604 18:41865696-41865718 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1156943119 18:42795187-42795209 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1156961014 18:43030990-43031012 AGATCTTGCAGGCCTGGCTAAGG - Intronic
1157483988 18:48073952-48073974 ACCCACTGCAGGCCTGGCTGGGG - Intronic
1158282356 18:55841116-55841138 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1158351859 18:56572229-56572251 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1158460786 18:57644035-57644057 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1158551291 18:58438286-58438308 GTCCCTTGGTGGCCAGGCTAAGG - Intergenic
1158697318 18:59714513-59714535 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1158705812 18:59790872-59790894 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1159322164 18:66866640-66866662 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1159473007 18:68880416-68880438 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1160198494 18:76777184-76777206 GCCCCTTTCCGGGCTGGCCAAGG + Intergenic
1160532225 18:79572142-79572164 CCTCCCTGCAGCCCTGGCTAAGG - Intergenic
1160878319 19:1308240-1308262 GCCCCTGGGAGGCCTGGGCAGGG - Intergenic
1161858939 19:6783432-6783454 GCCACTTCCAGGCCTGGCCTGGG - Intronic
1162106942 19:8375699-8375721 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1162230084 19:9259453-9259475 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1162237591 19:9321339-9321361 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1162262103 19:9541745-9541767 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1162296896 19:9819536-9819558 ACGCCTTGGAGGCGTGGCTAGGG + Intronic
1162590765 19:11589623-11589645 GCTCCTTCCTGCCCTGGCTATGG - Intronic
1163181781 19:15609066-15609088 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1163577892 19:18121507-18121529 GGGCCTTGAAGACCTGGCTAAGG + Intronic
1163714858 19:18867763-18867785 GCCCCTCGAACGCCTGGCTTGGG + Exonic
1163738211 19:18994805-18994827 GACCCTGGCTGGCCCGGCTATGG + Intronic
1163777495 19:19226899-19226921 CCCCCTTGCAGCCCCGGCTCCGG - Exonic
1164144083 19:22499410-22499432 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1164270647 19:23668948-23668970 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1164310400 19:24041253-24041275 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1164975738 19:32571527-32571549 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1164995711 19:32719652-32719674 GGCCCTGGGAGGCCCGGCTAGGG - Intergenic
1165036331 19:33036578-33036600 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1165266880 19:34668133-34668155 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1165415590 19:35691481-35691503 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1166036282 19:40170562-40170584 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1166343681 19:42152611-42152633 GCCCCTCAGAGGCCTGGGTAAGG - Intronic
1166487069 19:43222352-43222374 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1166649782 19:44563626-44563648 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1167649721 19:50722733-50722755 GCCTCCTGCAGGCCAGGCTGTGG - Intergenic
925537866 2:4935735-4935757 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
926474828 2:13308712-13308734 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
926850612 2:17193493-17193515 GCCCCTTTCTGGTCTGGCCAAGG + Intergenic
927357025 2:22186282-22186304 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
927900372 2:26814410-26814432 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
928701596 2:33903933-33903955 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
928753138 2:34494232-34494254 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
928936838 2:36688200-36688222 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
929201799 2:39244214-39244236 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
929233655 2:39585305-39585327 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
929379630 2:41335529-41335551 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
929890935 2:45918095-45918117 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
930037957 2:47099671-47099693 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
930039153 2:47107219-47107241 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
930468273 2:51780708-51780730 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
930485448 2:52006738-52006760 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
931708637 2:64968943-64968965 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
932178225 2:69622022-69622044 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
932239880 2:70148267-70148289 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
932359577 2:71092908-71092930 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
932486417 2:72086829-72086851 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
932521720 2:72421767-72421789 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
932570627 2:72936554-72936576 GCCCCCCGCAGGCCTGGCCTCGG - Intergenic
932983528 2:76698541-76698563 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
933060895 2:77735176-77735198 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
933511523 2:83246347-83246369 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
933712202 2:85334772-85334794 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
934708971 2:96503074-96503096 GCTCCATGCAGGACTGGCTCTGG + Intronic
935896914 2:107747760-107747782 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
936172756 2:110190614-110190636 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
936346827 2:111681789-111681811 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
937596792 2:123683712-123683734 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
937746542 2:125422185-125422207 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
937988536 2:127649593-127649615 GCCACTCGCAGGCCTGGGTTGGG + Intronic
938079916 2:128364496-128364518 GCTCCTTCCAGGCCCGGCCAGGG + Intergenic
938126137 2:128672546-128672568 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
938400969 2:130991386-130991408 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
939003080 2:136758400-136758422 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
939053277 2:137332028-137332050 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
939275267 2:139991120-139991142 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
939465068 2:142546000-142546022 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
939509639 2:143089856-143089878 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
939738839 2:145881332-145881354 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
939777411 2:146404113-146404135 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
939972591 2:148678809-148678831 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
940215046 2:151295949-151295971 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
940666764 2:156618481-156618503 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
940784656 2:157968292-157968314 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
941186799 2:162328054-162328076 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
941240022 2:163026209-163026231 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
941309186 2:163909461-163909483 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
941309729 2:163913551-163913573 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
941397992 2:164995178-164995200 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
941712180 2:168725319-168725341 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
941820733 2:169841472-169841494 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
942247880 2:174024100-174024122 TGCCCCTGCAGGCCTGGCCACGG + Intergenic
942299653 2:174548968-174548990 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
943106211 2:183547067-183547089 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
943166130 2:184328074-184328096 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
943789994 2:191921596-191921618 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
943835103 2:192507907-192507929 GCCCCTTCCTGGGCTGGCCAAGG + Intergenic
944228374 2:197370511-197370533 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
944482744 2:200174723-200174745 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
944713447 2:202356646-202356668 GTACCATGCAGGTCTGGCTATGG - Intergenic
944729581 2:202503322-202503344 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
944843191 2:203643248-203643270 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
944857991 2:203785997-203786019 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
945401342 2:209387318-209387340 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
945575535 2:211524797-211524819 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
945745721 2:213718430-213718452 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
946053937 2:216885188-216885210 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
946358145 2:219201849-219201871 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
946923624 2:224604123-224604145 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
947411931 2:229850657-229850679 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
947490419 2:230590052-230590074 TCCCCTTGCAGACATGGCCATGG + Intergenic
947720365 2:232366279-232366301 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
947745925 2:232507253-232507275 GCCCATGGCAGTCCTGGCTCCGG - Intergenic
947932116 2:233972889-233972911 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
948402233 2:237692377-237692399 GCCCCTCGCGGGCCGGGCCAGGG - Exonic
948449174 2:238058279-238058301 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1169129666 20:3159593-3159615 GCCTCTCGCAGGCCTGGCTGTGG - Intronic
1169282159 20:4277183-4277205 GCCCCTTGCAGTCAAGGCCAGGG + Intergenic
1169645403 20:7803937-7803959 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1169814514 20:9642010-9642032 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1169849136 20:10031620-10031642 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1170230924 20:14045204-14045226 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1170649447 20:18226704-18226726 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1170989826 20:21291813-21291835 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1171118730 20:22549687-22549709 GCCCCTTTCAGCCATGGCTGGGG + Intergenic
1171318910 20:24221142-24221164 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1172431918 20:34899224-34899246 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1173012057 20:39191508-39191530 GCCCCTTGCAGGACTTTCAAAGG + Intergenic
1173225498 20:41160207-41160229 GCTACTTAGAGGCCTGGCTAAGG - Intronic
1173601539 20:44299072-44299094 GCCCCTTTCTGGGCTGGCTAAGG + Intergenic
1173866875 20:46317886-46317908 GTCCCTGGCAGGTCTGGCTCTGG + Intergenic
1174162939 20:48564484-48564506 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1174391246 20:50219593-50219615 TCTCCTTGCAGCCCTGACTATGG + Intergenic
1174398050 20:50260067-50260089 GCCCCTCACAGGACTGGCCATGG - Intergenic
1175184118 20:57168251-57168273 GCCCCCAGCAGGCCTGGCGAAGG - Intergenic
1175254094 20:57628740-57628762 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1175397325 20:58675328-58675350 GCCTCTTCCAGACCTTGCTATGG - Intronic
1175860340 20:62147149-62147171 GCTCCATGCAGGCCAGGCTCGGG - Intronic
1176332335 21:5560011-5560033 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1176395422 21:6260940-6260962 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1176441735 21:6728164-6728186 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1176465997 21:7055233-7055255 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1176489558 21:7437011-7437033 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1176710550 21:10146243-10146265 GCTCCTTGCAGGCCTGACAAAGG + Intergenic
1176791571 21:13325245-13325267 GCCCCAAGCTGACCTGGCTATGG - Intergenic
1176966677 21:15218997-15219019 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1177182451 21:17758008-17758030 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1177496872 21:21902356-21902378 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1177637553 21:23806956-23806978 GCCCCTTTCTGGCCTGGCCAAGG + Intergenic
1177990215 21:28028070-28028092 GCCCCAAGCTGACCTGGCTATGG + Intergenic
1178074122 21:29000115-29000137 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1178326942 21:31654134-31654156 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1178398684 21:32265270-32265292 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1178983411 21:37283607-37283629 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1180033216 21:45226613-45226635 TCCACTAGCAGGCCTGGGTATGG + Intergenic
1180741106 22:18053778-18053800 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1181077719 22:20392778-20392800 GCCCCTTCCTGGGCTGGCTGCGG - Intergenic
1181159159 22:20946920-20946942 TCCAGTTACAGGCCTGGCTATGG - Intronic
1181450606 22:23017440-23017462 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1182858408 22:33538015-33538037 ACCCCTTGCAGGCCTGCTTCCGG + Intronic
1183217746 22:36492112-36492134 GCCCCTGGGAGGCCAGGCCATGG + Intronic
1183563143 22:38592980-38593002 GCCACAGGCAGGTCTGGCTATGG - Intronic
1183685155 22:39357476-39357498 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1184584197 22:45436667-45436689 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1185364587 22:50431604-50431626 TCCACGTGCAGGCCTGGCAAGGG + Intronic
950068996 3:10136787-10136809 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
950207835 3:11093975-11093997 GCCCCTTCCTGGCATGGCTGAGG + Intergenic
950256710 3:11512017-11512039 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
950257020 3:11513664-11513686 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
950470112 3:13179694-13179716 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
950513424 3:13447618-13447640 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
950553116 3:13679527-13679549 GCTCCATGCAGGCATGGATATGG - Intergenic
950600430 3:14029916-14029938 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
950929340 3:16773656-16773678 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
951332998 3:21387630-21387652 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
951734744 3:25851704-25851726 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
952058147 3:29473923-29473945 GCCCCTTTCTGGTCTGGCCAAGG - Intronic
952275187 3:31870060-31870082 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
952360411 3:32625578-32625600 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
952393656 3:32902733-32902755 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
952730580 3:36633846-36633868 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
952795186 3:37232943-37232965 GCCCCTTTCTGGTCTGGCCAAGG + Intergenic
953002829 3:38951091-38951113 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
953089765 3:39713255-39713277 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
953522549 3:43656847-43656869 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
953674128 3:44986518-44986540 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
953771075 3:45779121-45779143 GTCCCATGAAGGCCTGGCTCAGG + Intronic
953871611 3:46631700-46631722 GACCCTTGGAGGCATGGCTGTGG - Intergenic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
955183292 3:56691819-56691841 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
955186367 3:56718873-56718895 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
955210233 3:56934405-56934427 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
955266514 3:57449767-57449789 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
955370367 3:58346186-58346208 GCCTCTTGGATGCCAGGCTAAGG + Intronic
955759212 3:62259927-62259949 GGACCTTGAAAGCCTGGCTAAGG + Intronic
956195683 3:66651510-66651532 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
956481402 3:69677392-69677414 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
956563579 3:70611795-70611817 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
956855201 3:73269132-73269154 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
957009242 3:74985547-74985569 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
957074029 3:75587738-75587760 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
957371426 3:79300159-79300181 GCCCCTTCCTGGGCTGGCCAAGG + Intronic
957446085 3:80314442-80314464 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
957556358 3:81767808-81767830 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
957804965 3:85134282-85134304 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
957919712 3:86731849-86731871 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
957921758 3:86757532-86757554 GCCCCTTTCTGGGCTGGCTGAGG + Intergenic
957995045 3:87679036-87679058 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
958022573 3:88015629-88015651 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
958632363 3:96700361-96700383 CCCCCTTGCAGGGCATGCTATGG - Intergenic
958810807 3:98858345-98858367 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
960149863 3:114238711-114238733 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
960199461 3:114813075-114813097 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
960282076 3:115791501-115791523 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
960685447 3:120289655-120289677 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
960868636 3:122227597-122227619 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
961280054 3:125758999-125759021 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
961460407 3:127046616-127046638 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
961462087 3:127056991-127057013 GCCCCTTTCTGCCCTGGCTTGGG + Intergenic
961465101 3:127076662-127076684 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
961648377 3:128404815-128404837 GGCCCTTGCACGCCTGCCTGAGG - Intronic
961746777 3:129068690-129068712 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
961874351 3:130010580-130010602 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
962072711 3:132048349-132048371 GGACCTTGCAGGCCAGGCTAAGG - Intronic
962283807 3:134070680-134070702 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
962398804 3:135039838-135039860 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
962591133 3:136890421-136890443 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
962758196 3:138484595-138484617 GCCCCTTTCAGGGCTGGCCAAGG + Intergenic
963047025 3:141110085-141110107 GCCCTTTGCAGCCCTGCCTTTGG + Intronic
963394587 3:144715508-144715530 GCCCCTTTCAGCCATGGCTGTGG + Intergenic
963509206 3:146225847-146225869 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
963590033 3:147245975-147245997 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
963673560 3:148280939-148280961 GCCCCTTTCTAGCCTGGCCAAGG - Intergenic
963743060 3:149098270-149098292 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
963744104 3:149109325-149109347 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
963760536 3:149283960-149283982 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
963862108 3:150322907-150322929 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
964014316 3:151928094-151928116 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
964118030 3:153156141-153156163 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
964139278 3:153378757-153378779 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
964409888 3:156386881-156386903 GGGCCTTGCAGCCCTGGCTTTGG - Intronic
964443946 3:156740517-156740539 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
964452199 3:156823098-156823120 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
964563004 3:158019118-158019140 GCCCCTTCCAGTCCTCTCTACGG - Intergenic
964791812 3:160460220-160460242 GCCTCTTCCAGGCCTGCCCATGG - Intronic
964802946 3:160574365-160574387 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
964977704 3:162640010-162640032 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965003466 3:162987290-162987312 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965044192 3:163552742-163552764 GCCCCTTTCTGGGCTGGCTAAGG - Intergenic
965077942 3:164002910-164002932 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965109484 3:164402333-164402355 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
965220948 3:165924727-165924749 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
965245297 3:166258889-166258911 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
965256733 3:166423916-166423938 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965287980 3:166842751-166842773 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965298069 3:166975773-166975795 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965446420 3:168780080-168780102 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965753288 3:171999292-171999314 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
965770909 3:172180275-172180297 GCCCCTTGCAGACCTGTTGAGGG + Intronic
965837310 3:172866720-172866742 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
965943546 3:174212393-174212415 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
966076017 3:175937314-175937336 GCCCCTTTCTGGGCTGGCAAAGG + Intergenic
966246134 3:177809317-177809339 GCCCCTTTCTGGACTGGCCAAGG - Intergenic
966372471 3:179263429-179263451 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
966549015 3:181183408-181183430 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
966724945 3:183100836-183100858 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
968412854 4:404380-404402 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
968469630 4:773498-773520 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
968538572 4:1150539-1150561 GCCCCTTGCTTGCCATGCTATGG - Intergenic
968701495 4:2060022-2060044 GCCCCGCGCAGGGCTGGCTATGG + Intronic
968716105 4:2161209-2161231 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
968830968 4:2932919-2932941 GCTCCTTGAAAGCCTGGCTCTGG + Intronic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
969017662 4:4115340-4115362 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
969362299 4:6672663-6672685 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
969440682 4:7215068-7215090 GCCCCTTCCTGGGCTGGCCAAGG + Intronic
969795526 4:9524834-9524856 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
970108262 4:12609573-12609595 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
970182542 4:13415338-13415360 GCCCCTTCCTGGGCTGGCTGAGG + Intronic
970272069 4:14358605-14358627 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
970391160 4:15614853-15614875 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
970649384 4:18159690-18159712 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
970673220 4:18418759-18418781 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
970803466 4:20003953-20003975 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
971281735 4:25247036-25247058 GCCCCTTTCTGGGCTGGCGAAGG - Intronic
971553094 4:27978756-27978778 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
971709408 4:30092647-30092669 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
971811895 4:31438591-31438613 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
972034848 4:34506999-34507021 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
972749348 4:41973120-41973142 GCCCCTTTCAGCCATGGCTGAGG - Intergenic
972900072 4:43672297-43672319 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
973144313 4:46805211-46805233 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
973190369 4:47378475-47378497 GCCCCTTCCTGGGCTGGCTGAGG - Intronic
973308023 4:48675280-48675302 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
973587815 4:52410166-52410188 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
973765152 4:54155544-54155566 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
973854059 4:54993455-54993477 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
974484847 4:62492317-62492339 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
974590653 4:63943295-63943317 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
974641800 4:64640894-64640916 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
974757973 4:66237259-66237281 GTCCCTTGCATGGCTAGCTATGG - Intergenic
974792823 4:66712834-66712856 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
974804327 4:66860108-66860130 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
974992927 4:69115664-69115686 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
975298761 4:72765838-72765860 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
975595241 4:76043707-76043729 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
975596425 4:76051077-76051099 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
975744904 4:77466325-77466347 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
975755820 4:77570604-77570626 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
975778572 4:77817441-77817463 GCCTCCTGCAGCCCTGACTATGG - Intronic
975898373 4:79121872-79121894 GCCCCTTCCTGGGCTGGCTGAGG + Intergenic
975994887 4:80302777-80302799 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
976406329 4:84664657-84664679 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
976520686 4:86022029-86022051 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
976646921 4:87396367-87396389 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
976666649 4:87601624-87601646 TCCTCTTGCAGGCTTGGCTGAGG - Intergenic
976736338 4:88313566-88313588 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
976980355 4:91218390-91218412 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
977751022 4:100609186-100609208 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
978249269 4:106610631-106610653 TCCTCTTCCAGGCCTGCCTATGG + Intergenic
978285471 4:107073037-107073059 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
978310705 4:107382397-107382419 GCCCCTTGAAAGCCTTGCTTAGG - Intergenic
978463672 4:108984773-108984795 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
978998108 4:115179837-115179859 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
979224129 4:118265488-118265510 GCCCCTTTCCGGGCTGGCTGAGG + Intergenic
979424807 4:120551158-120551180 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
979688526 4:123537857-123537879 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
979755814 4:124338993-124339015 GCGCCTTGCTGGGCTGGCCAAGG + Intergenic
979857559 4:125652150-125652172 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
979899772 4:126201711-126201733 GCCCCTTTCAGGGCTGGCCAAGG - Intergenic
980043440 4:127964658-127964680 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
980100635 4:128538538-128538560 GCCCCTTGCACGCCCTGCAAGGG - Intergenic
980628541 4:135406557-135406579 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
980799708 4:137733676-137733698 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
980815496 4:137942010-137942032 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
980824161 4:138053321-138053343 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
980827401 4:138089115-138089137 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
982132657 4:152244509-152244531 GCAGCTTGCAGGCCTGGGCATGG + Intergenic
982408169 4:155044243-155044265 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
982647623 4:158044111-158044133 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
982679045 4:158408011-158408033 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
982692724 4:158566883-158566905 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
982728133 4:158927641-158927663 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
982863326 4:160481709-160481731 GCCCCTTTCAGGGCTGGCCAAGG + Intergenic
982985703 4:162203528-162203550 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
983553111 4:169036256-169036278 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
984192894 4:176625584-176625606 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
984265599 4:177495532-177495554 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
984770512 4:183433114-183433136 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
984776166 4:183483084-183483106 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
984852907 4:184169224-184169246 GCTCCTCGCTGGCCTGGCTAGGG - Intronic
985087038 4:186324524-186324546 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
985195229 4:187421369-187421391 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
985203193 4:187505571-187505593 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
985366340 4:189236247-189236269 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
986121080 5:4837482-4837504 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
986151945 5:5137725-5137747 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
986661680 5:10065419-10065441 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
986697941 5:10375098-10375120 GCCCCTTTCTGGCCTGGCCAAGG + Intronic
986912448 5:12574365-12574387 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
987146307 5:14994226-14994248 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
987156847 5:15096976-15096998 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
987315239 5:16717891-16717913 GCCCCTTTCTGGTCTGGCCAAGG + Intronic
987358171 5:17083401-17083423 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
987364985 5:17140868-17140890 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
987384070 5:17312193-17312215 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
987461976 5:18223231-18223253 GCCCCTTTTAGCCATGGCTAGGG - Intergenic
987532843 5:19143191-19143213 GCCCCTTTCTGGACTGGCCAAGG - Intergenic
987543770 5:19287684-19287706 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
987876895 5:23691064-23691086 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
987896233 5:23951216-23951238 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
988073432 5:26324361-26324383 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
988087043 5:26485700-26485722 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
988177204 5:27743401-27743423 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
988201832 5:28078073-28078095 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
988279609 5:29128043-29128065 GCCCCTTTCTGGGCTGGCAAAGG - Intergenic
988489189 5:31692385-31692407 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
988684795 5:33515807-33515829 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
988915953 5:35893288-35893310 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
989003147 5:36782521-36782543 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
989346742 5:40438599-40438621 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
989957876 5:50376772-50376794 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
990243204 5:53836910-53836932 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
990345206 5:54865017-54865039 GCCCCTTTCTGGGCTGGCTAAGG + Intergenic
990461467 5:56035429-56035451 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
990490020 5:56295292-56295314 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
990734085 5:58841089-58841111 GCCCCCTGCAGACATGGCTGTGG - Intronic
990880173 5:60530259-60530281 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
991330279 5:65485852-65485874 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
992947320 5:81823213-81823235 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
992947390 5:81823662-81823684 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
993320989 5:86467101-86467123 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
993328636 5:86569944-86569966 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
993529241 5:89004035-89004057 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
993770224 5:91917214-91917236 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
994096282 5:95851105-95851127 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
994229910 5:97301088-97301110 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
994254848 5:97580413-97580435 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
994507049 5:100656703-100656725 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
994509896 5:100689287-100689309 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
994647806 5:102491767-102491789 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
994701759 5:103142458-103142480 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
994932486 5:106206465-106206487 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
995568618 5:113457084-113457106 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
995596508 5:113753538-113753560 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
995656453 5:114432621-114432643 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
995920338 5:117304601-117304623 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
996106992 5:119517044-119517066 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
996164225 5:120205281-120205303 CTCCCTGGCAGGCCTGACTAGGG + Intergenic
996234166 5:121107117-121107139 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
996435634 5:123430487-123430509 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
996815516 5:127569395-127569417 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
997158249 5:131580455-131580477 GCCCCTCTCAGGGCTGGCTGAGG - Intronic
997352160 5:133238931-133238953 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
997760502 5:136444153-136444175 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
997850930 5:137332049-137332071 GGGCCTTGCAGGCCTTGCTGAGG - Intronic
999300770 5:150488905-150488927 GAGACTTGCAGGCCTGGCTTTGG - Intronic
999348495 5:150845404-150845426 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
999406122 5:151309127-151309149 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1000212311 5:159119113-159119135 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1000432408 5:161166526-161166548 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1000609095 5:163355809-163355831 GCCCCTTCCTGGGCTGGCTGAGG + Intergenic
1000889353 5:166784866-166784888 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1000891876 5:166810616-166810638 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1000903592 5:166936636-166936658 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1001960630 5:175878665-175878687 GCTCCTGGCTGGCCTGGCTTGGG - Exonic
1002310164 5:178309334-178309356 GCCCCCTGCAGGCCTGGAGCTGG + Intronic
1002790785 6:435960-435982 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1003060670 6:2860084-2860106 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1003081858 6:3027642-3027664 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1003170905 6:3721185-3721207 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1003213693 6:4090082-4090104 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1003284904 6:4725726-4725748 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1003441344 6:6145562-6145584 GCCTCTTGTAGTCTTGGCTAAGG - Exonic
1003489277 6:6606846-6606868 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1003508890 6:6762900-6762922 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1003531318 6:6940031-6940053 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1003577984 6:7315158-7315180 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1003578347 6:7317154-7317176 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1003581388 6:7344157-7344179 GCCCCTTTCTGGGCTGGCCACGG + Intronic
1003593662 6:7456302-7456324 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1003641728 6:7880859-7880881 GCCCCGTGGAGCCCTGGCTGTGG - Exonic
1003717569 6:8665652-8665674 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1003836270 6:10075098-10075120 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1003845674 6:10171663-10171685 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1003897065 6:10617437-10617459 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1003982526 6:11403002-11403024 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1004036900 6:11932965-11932987 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004053210 6:12108810-12108832 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1004196640 6:13511450-13511472 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1004200216 6:13541480-13541502 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004224347 6:13772435-13772457 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004905386 6:20233158-20233180 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004906985 6:20245190-20245212 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1004908466 6:20259508-20259530 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004912581 6:20301202-20301224 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1004914392 6:20318859-20318881 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1005042317 6:21610281-21610303 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1005059229 6:21761099-21761121 GCCCTTTCCTGGCCTGGCTGAGG + Intergenic
1005332935 6:24766356-24766378 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1005561388 6:27045226-27045248 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1005596267 6:27381478-27381500 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1005600930 6:27425248-27425270 GCCCCTTTCTGGGCTGGCAAAGG - Intergenic
1005707503 6:28469773-28469795 GCCCCTTTCGGGGCTGGCCAAGG - Intergenic
1005749117 6:28866861-28866883 GCCCCTTGCTGGGCTGGCCAAGG - Intergenic
1005749986 6:28873013-28873035 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1005758949 6:28950213-28950235 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1005759751 6:28957785-28957807 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1005978295 6:30816717-30816739 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1006005718 6:31000416-31000438 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1006033579 6:31195401-31195423 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1006119080 6:31793067-31793089 GCCCCTTGGAGGAGTGGCTTCGG - Exonic
1006352587 6:33532330-33532352 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1006477774 6:34268966-34268988 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1006748953 6:36364652-36364674 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1006935597 6:37715474-37715496 GCCCCTTGCAGGGCAGGACAGGG - Intergenic
1007738678 6:43998038-43998060 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1008005646 6:46406186-46406208 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1008270243 6:49482243-49482265 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1008270544 6:49483837-49483859 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1008770940 6:54979176-54979198 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1009407152 6:63326874-63326896 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1009471365 6:64031097-64031119 GCCCCTTTCTGGTCTGGCCAAGG + Intronic
1009587595 6:65627466-65627488 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1009664371 6:66655782-66655804 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1009685278 6:66949156-66949178 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1009800671 6:68533374-68533396 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1010066242 6:71686100-71686122 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1010199370 6:73269293-73269315 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1010235708 6:73572956-73572978 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1010278001 6:73991050-73991072 GCCCCTTTCTGGTCTGGCCAAGG - Intergenic
1010617322 6:78029739-78029761 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1011143634 6:84189308-84189330 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1011178076 6:84587372-84587394 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1011246467 6:85325919-85325941 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1011338402 6:86285196-86285218 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1011620142 6:89234866-89234888 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1012245844 6:96924699-96924721 GCCACCTGCAGTGCTGGCTAGGG + Intronic
1012405725 6:98895022-98895044 GCCTGCTGCATGCCTGGCTATGG + Intronic
1012578271 6:100829612-100829634 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1012760558 6:103294823-103294845 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1013025779 6:106269826-106269848 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1013143624 6:107364665-107364687 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1013410833 6:109881561-109881583 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1013694872 6:112689811-112689833 GCCCCTTTCTGGGCTGGCTAAGG - Intergenic
1013955403 6:115835020-115835042 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1014240688 6:119015264-119015286 GCCCCTTTCTGGACTGGCCAAGG + Intronic
1014280753 6:119440940-119440962 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1014499315 6:122165477-122165499 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1014718510 6:124891913-124891935 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1014788414 6:125644392-125644414 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1014921131 6:127215010-127215032 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1015600288 6:134904671-134904693 GCCCCTTTCTGGACTGGCCAAGG + Intergenic
1015831202 6:137370764-137370786 GGCCCTTGCATGGCTGGCTGTGG + Intergenic
1016067429 6:139698335-139698357 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1016176291 6:141081293-141081315 GCCCCTTTCAGCCATGGCTGGGG - Intergenic
1016614218 6:146028353-146028375 GTCCCTTGCAGGCCCTGCCAGGG + Intronic
1016858973 6:148698464-148698486 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1016859113 6:148699001-148699023 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1016862108 6:148731093-148731115 GCCCCTTCCAGGCCTTGCACCGG - Intergenic
1017028537 6:150201447-150201469 GCCCTGTGGAGGCCTGGCTGGGG + Intronic
1017310101 6:152966349-152966371 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1017325028 6:153133562-153133584 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1018064293 6:160114921-160114943 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1018545618 6:164933240-164933262 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1018624705 6:165765706-165765728 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1018903966 6:168064554-168064576 GCCCCTTGGCTGCCTGGCTGTGG - Intronic
1019000324 6:168744205-168744227 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1019372806 7:671826-671848 GCCCGTTCCAGGCATGGCTGGGG - Intronic
1019944324 7:4314356-4314378 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1020008228 7:4793469-4793491 GCCCCTTTCAGGGCTGGCCAAGG + Intronic
1020098331 7:5380682-5380704 GCCCCTTGCAGTCCTGACTGAGG - Intronic
1021065813 7:16170993-16171015 GCCCCTCTCTGGGCTGGCTAAGG - Intronic
1021073654 7:16273953-16273975 CCCCTTCGCAGGACTGGCTAAGG - Intronic
1021324068 7:19245424-19245446 GCCCCTTTCTGGGCTGGCCAGGG + Intergenic
1021520749 7:21536955-21536977 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1021686816 7:23194147-23194169 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1022174194 7:27857432-27857454 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1022750377 7:33218914-33218936 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1022966929 7:35482585-35482607 GCCCCTTCCAGGCCTTTCTATGG - Intergenic
1023029267 7:36078815-36078837 GCCCACTGCAGCCCTGGCGATGG + Intergenic
1023453032 7:40308534-40308556 GGTCCTTGCAGGCCTGGGTAAGG - Intronic
1023848252 7:44135468-44135490 GGGCCCTGCAGGCCTGGCCAGGG + Intergenic
1024269019 7:47628417-47628439 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1024443803 7:49453636-49453658 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1024700691 7:51901315-51901337 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1024825479 7:53385582-53385604 GCCCCTTTCTGGACTGGCCAAGG - Intergenic
1024833988 7:53494961-53494983 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1025962127 7:66231760-66231782 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1026202892 7:68230989-68231011 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1026335839 7:69393769-69393791 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1026596614 7:71738499-71738521 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1026765590 7:73157492-73157514 GCCCCCTGCCTGCCTGGCTGAGG + Intergenic
1027042063 7:74967185-74967207 GCCCCCTGCCTGCCTGGCTGAGG + Intronic
1027081578 7:75235169-75235191 GCCCCCTGCCTGCCTGGCTGAGG - Intergenic
1027564101 7:79768384-79768406 TCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1027579773 7:79978029-79978051 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1027665836 7:81042649-81042671 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1027667586 7:81057896-81057918 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1027674412 7:81141687-81141709 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1027698342 7:81437508-81437530 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1027778907 7:82499553-82499575 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1027868038 7:83673258-83673280 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1027955989 7:84880509-84880531 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1027996751 7:85434521-85434543 GCCCCTTTCAGTCATGGCTAGGG - Intergenic
1028142448 7:87288664-87288686 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1028303350 7:89229148-89229170 GCCCCTTCCTGGGCTGGCCAAGG - Intronic
1028511280 7:91627813-91627835 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1028558086 7:92143745-92143767 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1028762537 7:94510611-94510633 GCCCCTTGCAGGGCGGCCTTGGG - Intronic
1028778266 7:94705435-94705457 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1028944256 7:96558881-96558903 GACCCTTGCAGCCCTGCTTATGG + Intronic
1029026099 7:97418466-97418488 GCTACTTGCAGGCCTGGATTTGG + Intergenic
1029076103 7:97935870-97935892 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1029567455 7:101348515-101348537 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1029691325 7:102183876-102183898 GCCTCTGGCAGGTCTGACTAAGG - Intronic
1029832431 7:103275345-103275367 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1030102173 7:105956177-105956199 GCCCCTTCCTGGGCTGGCTGAGG - Intronic
1030215776 7:107042738-107042760 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1030780354 7:113593260-113593282 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1030819373 7:114077262-114077284 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1031109914 7:117596088-117596110 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1031605577 7:123763591-123763613 GCCCCTTTCTGGACTGGCCAAGG - Intergenic
1031902813 7:127429106-127429128 GCCCCTTTCTGGGCTGGCTGAGG + Intronic
1032094204 7:128929530-128929552 GCCCCTGGCAGGGCTGGGAAGGG - Intergenic
1032248019 7:130229962-130229984 GCCCCTTTCTGGGCTGGCCACGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032561665 7:132899027-132899049 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1033065026 7:138146104-138146126 GCCCCTTTCCGGGCTGGCCAAGG + Intergenic
1033312486 7:140271725-140271747 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1033394140 7:140957364-140957386 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1033759602 7:144424459-144424481 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1033866698 7:145697789-145697811 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1034090986 7:148363757-148363779 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1034154959 7:148949021-148949043 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1034167810 7:149039117-149039139 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1034266536 7:149783735-149783757 CCCCCTTCCAGGAATGGCTAGGG + Intergenic
1034632195 7:152539280-152539302 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1034656100 7:152730696-152730718 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1034967170 7:155398569-155398591 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
1034976796 7:155453817-155453839 GCCCCTGGCAGGCCTGGGGCGGG + Intergenic
1035663427 8:1363828-1363850 GCCCGTGGCAGGCCTGGCCTTGG + Intergenic
1036123880 8:6045438-6045460 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1036260427 8:7235638-7235660 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1036312464 8:7694194-7694216 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1036441094 8:8781812-8781834 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1036554709 8:9848176-9848198 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1036831320 8:12022602-12022624 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1037064956 8:14566762-14566784 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1037263898 8:17037238-17037260 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1037810913 8:22086494-22086516 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1037971398 8:23174220-23174242 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1037983471 8:23272058-23272080 GCCCCTTTCTGGGCTGGCCAGGG + Intronic
1038174013 8:25164436-25164458 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1038638222 8:29304193-29304215 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1038639346 8:29311405-29311427 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1038847657 8:31244526-31244548 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1038870643 8:31489796-31489818 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1039061246 8:33573843-33573865 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1039068681 8:33631618-33631640 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1039069170 8:33634253-33634275 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1039284809 8:36028766-36028788 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1039587558 8:38719805-38719827 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1039637243 8:39180054-39180076 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1040026495 8:42786715-42786737 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1040027520 8:42795592-42795614 GCCCCTCTCAGGGCTGGCTGAGG + Intronic
1040323909 8:46331673-46331695 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1040723070 8:50349858-50349880 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1041437990 8:57863058-57863080 GCCGCTTTCAGCCATGGCTAGGG - Intergenic
1041636731 8:60153376-60153398 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1041914468 8:63126049-63126071 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1041918874 8:63161929-63161951 GCCCCTTGCTGGGCTGGCCAAGG + Intergenic
1043129998 8:76448034-76448056 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1043346401 8:79303434-79303456 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1043352548 8:79377625-79377647 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1043435265 8:80231748-80231770 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1043701068 8:83290291-83290313 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1043857100 8:85276002-85276024 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1044088430 8:87971088-87971110 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1044404835 8:91816304-91816326 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1044633537 8:94300754-94300776 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1044788623 8:95823578-95823600 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1044853517 8:96452260-96452282 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1044880717 8:96719506-96719528 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1045131996 8:99163820-99163842 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1045232385 8:100317206-100317228 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1045467818 8:102485932-102485954 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1045942576 8:107755794-107755816 CCCCCTTGCAGGCCGTGCTATGG - Intergenic
1045956919 8:107919074-107919096 TACCCATGCAGGCCTGGCTGGGG - Intronic
1046149406 8:110202991-110203013 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1046265449 8:111823702-111823724 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1047100231 8:121667833-121667855 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1048556108 8:135478085-135478107 TCCCCTTGCACTCCTGTCTATGG + Intronic
1048655468 8:136530830-136530852 GCCCCTTTCTGGGCTGGCGAAGG - Intergenic
1048677019 8:136794210-136794232 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1048757559 8:137755541-137755563 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1048789114 8:138084075-138084097 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1049087697 8:140490935-140490957 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1049157652 8:141076627-141076649 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1049473465 8:142786477-142786499 GCTCCTTGCAGCCCTGGCTGTGG - Exonic
1049480326 8:142819529-142819551 GCCCCTCACAGGCCTGGGGAGGG + Intergenic
1049500255 8:142959419-142959441 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1049755767 8:144310726-144310748 GCCACCTCCAGGCCTGGCGAGGG + Intronic
1050088428 9:1991257-1991279 GCCACTTTCAAGCCTGGGTAGGG + Intergenic
1050249901 9:3733752-3733774 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1050891954 9:10835907-10835929 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1050920565 9:11196819-11196841 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1051305148 9:15700462-15700484 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1051383241 9:16480448-16480470 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1051439801 9:17072545-17072567 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1051463743 9:17353875-17353897 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1051892638 9:21959191-21959213 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1052014793 9:23451975-23451997 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1052075397 9:24135026-24135048 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1052979487 9:34437864-34437886 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1052985413 9:34483199-34483221 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1053285044 9:36844814-36844836 GCCCCTTGAAGGCCAGGCTGGGG - Intronic
1053547976 9:39042778-39042800 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1053812098 9:41862819-41862841 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1054618497 9:67324620-67324642 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1054636128 9:67492829-67492851 GCCCCTTGCCTGCCTGGTTCTGG - Intergenic
1054722385 9:68616963-68616985 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1055080839 9:72266306-72266328 GCCCCTTTCAGCCATGGCTGGGG + Intergenic
1055102628 9:72480622-72480644 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1055557637 9:77490803-77490825 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1055651317 9:78409937-78409959 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1056081026 9:83093727-83093749 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1056214315 9:84393436-84393458 GCCCCTTGCAGACCTTGCGGAGG - Intergenic
1056595136 9:88001878-88001900 GCCCCTTTCAGCCATGGCTGGGG - Intergenic
1056735883 9:89209343-89209365 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1056771459 9:89480839-89480861 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1056824446 9:89866819-89866841 TTCCCTTGCAGGCCTTGCTGAGG + Intergenic
1057294728 9:93828345-93828367 GCCCCTGGCAGGCCTTGGCAGGG + Intergenic
1057300649 9:93879881-93879903 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1057511079 9:95680271-95680293 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1057543918 9:96002140-96002162 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1057549119 9:96039274-96039296 GCCCCTTGCACCTCTGGCTGGGG - Intergenic
1057686359 9:97238240-97238262 GCCCCTAGCAGCCATGGTTATGG - Intergenic
1058174926 9:101724529-101724551 GCCCCTTTCTGGGCTGGCCAAGG - Intronic
1058235743 9:102487359-102487381 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1058286510 9:103186853-103186875 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1058585421 9:106501712-106501734 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1058727463 9:107817733-107817755 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1058799318 9:108530085-108530107 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1059810559 9:117851966-117851988 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1059891503 9:118809636-118809658 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1059991621 9:119870703-119870725 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1060432730 9:123564405-123564427 GGGCCTTCCAGGCCAGGCTAGGG - Intronic
1060594291 9:124839143-124839165 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1060778454 9:126393774-126393796 GCCCCTGCCAGCCCTGGCCAGGG - Intronic
1061483765 9:130910060-130910082 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1061856649 9:133445249-133445271 TCCCCTTGCAAGCCGGGCTGAGG + Intronic
1061955400 9:133958919-133958941 GCACCTCGCAGGCCTGGCCTGGG - Intronic
1062146269 9:134991452-134991474 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1062452990 9:136623316-136623338 GCCCCGTGCACTCCTGGCTCTGG + Intergenic
1202795311 9_KI270719v1_random:115238-115260 GCTCCTCGCAGGCCTGACAAAGG + Intergenic
1203429760 Un_GL000195v1:80321-80343 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1203442978 Un_GL000219v1:28651-28673 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1203513786 Un_KI270741v1:147560-147582 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1186293130 X:8121528-8121550 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1186295691 X:8145328-8145350 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1186618294 X:11212981-11213003 GCCCCCTGCAGGCATGCCCATGG + Intronic
1187005904 X:15232152-15232174 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1187138986 X:16575393-16575415 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1187304547 X:18083742-18083764 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1187450849 X:19394967-19394989 GCGCCCTACAGGCCTGGCTTAGG + Intronic
1187557635 X:20367271-20367293 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1187903955 X:24049631-24049653 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1188111953 X:26204742-26204764 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1188167010 X:26874081-26874103 GCCCCTTTCTGGGCTGGCTAAGG - Intergenic
1188189468 X:27156944-27156966 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1188242508 X:27809078-27809100 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1189368273 X:40406832-40406854 GCCCCTTCCAAGCTTGGCTCAGG - Intergenic
1189896893 X:45665189-45665211 GCCCCTTCCTGGGCTGGCCAAGG - Intergenic
1190010474 X:46780412-46780434 GCTCCCTGCTGGACTGGCTAAGG + Intergenic
1190041790 X:47078188-47078210 GCCCCTGGCAGGCCCGGGGATGG - Intergenic
1190045931 X:47111425-47111447 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1190131199 X:47750433-47750455 GCTCCCTGCAGGATTGGCTAAGG - Intergenic
1190414025 X:50163751-50163773 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1191618695 X:63192991-63193013 GCCCCTTTCTGGGCTGGCCACGG - Intergenic
1192186710 X:68952100-68952122 GCCCCTTCCTGGGCTGGCTGAGG + Intergenic
1192263493 X:69523367-69523389 GGCGCTTGCAGCCCTGGCCAGGG - Intronic
1192553067 X:72069311-72069333 GCCACTTTCAGGGCTTGCTAGGG + Intergenic
1193040250 X:76997063-76997085 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1193346706 X:80412184-80412206 GCCCCTTTCAGCCATGGCTGGGG + Intronic
1193538222 X:82738625-82738647 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1194071657 X:89331451-89331473 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1194166284 X:90521274-90521296 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1194650886 X:96512673-96512695 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1194890539 X:99372457-99372479 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1195258090 X:103107771-103107793 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196197981 X:112855276-112855298 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196319597 X:114270981-114271003 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196616090 X:117769007-117769029 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1196662576 X:118283125-118283147 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196714551 X:118798895-118798917 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1196728996 X:118922406-118922428 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196741460 X:119029453-119029475 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1196762401 X:119211301-119211323 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196775143 X:119331813-119331835 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1196781523 X:119388006-119388028 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196794042 X:119488285-119488307 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1196799928 X:119533289-119533311 GGGCCTTGCAGGCCTGAATAAGG - Intergenic
1196844997 X:119890540-119890562 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1197339987 X:125255586-125255608 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1197365701 X:125562620-125562642 CCCCCTTGGAGGCCTATCTAAGG + Intergenic
1197376864 X:125691001-125691023 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1198299924 X:135325395-135325417 GCCCCTTTCTGGGCTGGCCAAGG + Intronic
1198872358 X:141188920-141188942 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1199010006 X:142746145-142746167 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1199028859 X:142972558-142972580 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1199050290 X:143229112-143229134 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1199175477 X:144783572-144783594 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1199833083 X:151563201-151563223 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1200423622 Y:2998797-2998819 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1200512555 Y:4099055-4099077 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1200725899 Y:6667180-6667202 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1201285538 Y:12375406-12375428 GCCCCTTTCCGGGCTGGCCAAGG - Intergenic
1201423102 Y:13820626-13820648 GCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1201429134 Y:13887800-13887822 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1201468284 Y:14309226-14309248 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1201469062 Y:14314430-14314452 GCTCCTTTCTGGGCTGGCTAAGG + Intergenic
1201479874 Y:14428029-14428051 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1201556276 Y:15267238-15267260 GCCCCTTCCTGGACTGGCTGAGG + Intergenic
1202109781 Y:21407140-21407162 GCCCCTTTCTGGGCTGGCCAAGG + Intergenic