ID: 997625246

View in Genome Browser
Species Human (GRCh38)
Location 5:135326915-135326937
Sequence CCGTCCACAGAGGCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 413}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997625240_997625246 0 Left 997625240 5:135326892-135326914 CCCAAAACTGGCTTCAAGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625236_997625246 13 Left 997625236 5:135326879-135326901 CCGGGACACATCCCCCAAAACTG 0: 1
1: 0
2: 0
3: 16
4: 190
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625235_997625246 14 Left 997625235 5:135326878-135326900 CCCGGGACACATCCCCCAAAACT 0: 1
1: 0
2: 4
3: 13
4: 194
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625238_997625246 2 Left 997625238 5:135326890-135326912 CCCCCAAAACTGGCTTCAAGCTG 0: 1
1: 0
2: 0
3: 15
4: 220
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625239_997625246 1 Left 997625239 5:135326891-135326913 CCCCAAAACTGGCTTCAAGCTGT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625241_997625246 -1 Left 997625241 5:135326893-135326915 CCAAAACTGGCTTCAAGCTGTAC 0: 1
1: 0
2: 1
3: 12
4: 93
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625234_997625246 19 Left 997625234 5:135326873-135326895 CCACACCCGGGACACATCCCCCA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997625246 Original CRISPR CCGTCCACAGAGGCTGGCCA GGG Intronic
900134094 1:1106912-1106934 CCCTCCACAGCTGCTGGCCCAGG - Intronic
900347416 1:2216335-2216357 GCGTCCTCAGAGCCAGGCCACGG + Intergenic
900619314 1:3579769-3579791 CCTTGCCCACAGGCTGGCCATGG + Intronic
901115129 1:6837354-6837376 CTGTCCAGAGAGGCTGGCCAAGG + Intronic
901635091 1:10666759-10666781 CCTGCCACAAAGGCTGGCGAGGG + Intronic
901783348 1:11608896-11608918 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
901814789 1:11787943-11787965 TCGTCCACAGGGGCAGGCCTGGG - Exonic
902032133 1:13430695-13430717 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
902368061 1:15990211-15990233 CAGGACACAGAGGGTGGCCACGG - Intergenic
903595375 1:24490098-24490120 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
903665484 1:25004754-25004776 TTGTCATCAGAGGCTGGCCAGGG - Intergenic
903706193 1:25287504-25287526 CCGTCCCCAGGGGCAGGCCTGGG - Intronic
903721047 1:25405870-25405892 CCGTCCCCAGGGGCAGGCCTGGG + Intronic
903771979 1:25769901-25769923 CCCTCCCCATAGGGTGGCCACGG - Intronic
904198198 1:28801789-28801811 CTCTCCACAGAGCATGGCCAGGG - Intergenic
905228005 1:36492611-36492633 CCTTCCCCAGAGGCAGGCCCCGG - Intergenic
906540392 1:46581220-46581242 CTGTTCAGAGAGGCTGGGCATGG + Intronic
906877708 1:49556923-49556945 CCCTCCGCAGATGCTGGCCCAGG + Intronic
908124276 1:61014658-61014680 CCAGGCACAGAGGCTGGCCACGG - Intronic
908779313 1:67674883-67674905 GAGTGCACAGAGGCAGGCCAGGG - Intergenic
909782286 1:79561747-79561769 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
910625569 1:89303041-89303063 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
912935817 1:114002966-114002988 CCTCCCACAGAGACAGGCCAAGG - Intergenic
913105165 1:115607631-115607653 CTGTCCCCAGAAGCTGGGCACGG + Intergenic
915737826 1:158095737-158095759 CTGTCCACAGTGGGTAGCCAAGG - Intronic
917406337 1:174711536-174711558 CCCTCCACAGCTGCTGGCCCGGG - Intronic
917932996 1:179837152-179837174 CCGTCCGCAGCCGCTGGCCCGGG + Intergenic
918215800 1:182391433-182391455 CCCTTCCCAGAGCCTGGCCAAGG + Intronic
918732298 1:188013524-188013546 CCCTCCACAGCCGCTGGCCGAGG + Intergenic
918756656 1:188346034-188346056 CAGTCCACAGGGATTGGCCAGGG + Intergenic
919091905 1:192987049-192987071 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
919174475 1:194001980-194002002 CCCTCCACAGCCGCTGGCCTGGG - Intergenic
919419770 1:197355617-197355639 CCCTCCACAGCTGCTGGCCCGGG + Intronic
919812928 1:201420296-201420318 TCTTCCACAGAGCCTGGCAAGGG - Intronic
920604865 1:207371619-207371641 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
920731368 1:208488660-208488682 CCGTCCGCAGCCGCTGGCCCAGG + Intergenic
922184847 1:223265175-223265197 CTGTCCTCAGAGCCTGGGCATGG - Intronic
922369660 1:224896596-224896618 CTGGCTGCAGAGGCTGGCCAGGG - Intronic
922703509 1:227776160-227776182 AGGACCACAGAGTCTGGCCATGG + Intronic
923564995 1:235069943-235069965 CCGGCCACTGACGCTGGCCGGGG - Intergenic
923634266 1:235679845-235679867 TCTTCCACAGAGGCTGTCCAAGG + Intronic
924233345 1:241980388-241980410 CATTCTTCAGAGGCTGGCCATGG - Intergenic
924250737 1:242130687-242130709 TCGGCCACAGAGGCTGGACAGGG - Intronic
924305946 1:242689566-242689588 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1063977225 10:11427157-11427179 AAGACCACAGAGGCTGGGCACGG - Intergenic
1065101164 10:22334685-22334707 CCCTCCACAGCGGCAGGCCGAGG + Intergenic
1065331919 10:24611183-24611205 CAATCCACAGAGACTGGCCAAGG + Intronic
1065554906 10:26905684-26905706 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1066234047 10:33468172-33468194 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1066293626 10:34035533-34035555 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1066615059 10:37285388-37285410 CCCTCCACAGCTGCTGGCCTGGG + Intronic
1067290477 10:44935916-44935938 AGGACCACAGAGGCTGCCCAGGG + Exonic
1069616693 10:69810962-69810984 CCTGCCAGAGAGGCTGGGCATGG + Intronic
1071055302 10:81502995-81503017 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1071332587 10:84574636-84574658 CAGCCCACAGAGGAGGGCCATGG - Intergenic
1075505004 10:123013726-123013748 CCCTCCACAGCTGCTGGCCTGGG + Intronic
1075908560 10:126104157-126104179 CAATACACAGAGGCTGGACATGG + Intronic
1076138202 10:128059299-128059321 CAGCCCACACAGGGTGGCCAGGG - Intronic
1076192986 10:128495903-128495925 CTGTGCCCAGAGGCTGACCAAGG - Intergenic
1076686894 10:132202242-132202264 CCGTCCACACAGCCTGTCCCAGG + Intronic
1076794183 10:132790770-132790792 GGGTCCACAAAGGCTGGGCAGGG - Intergenic
1076800517 10:132825951-132825973 CCGGCCACAGAGACCAGCCACGG + Intronic
1076839616 10:133039576-133039598 GCGTCCACACGGGCTGGCGAGGG - Intergenic
1077304584 11:1863394-1863416 CCGTGCACAGATGGTGGCCCAGG + Intronic
1077465865 11:2733407-2733429 CCTTCCAGACAGGCTGGCCCAGG + Intronic
1077484569 11:2832855-2832877 TGGTCCACAGGGCCTGGCCAGGG + Intronic
1078102509 11:8338179-8338201 CCATACACAGGGCCTGGCCAAGG + Intergenic
1079767775 11:24416222-24416244 CCTTCCACAGCCGCTGGCCCGGG + Intergenic
1080204424 11:29712785-29712807 CCCTCCACAGCTGCTGGCCCTGG - Intergenic
1081115328 11:39192773-39192795 CCCTCCACAGCCGCTGGCCCAGG + Intergenic
1082912325 11:58390793-58390815 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1084087342 11:66860613-66860635 CTGTCCACAGGGGCGGCCCAGGG + Intronic
1084173178 11:67410272-67410294 CTGTCCCCAGAGGCTGGGCAGGG - Intronic
1084210464 11:67619175-67619197 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1084581118 11:70024141-70024163 CTGTCCACTGGGGCTGCCCAAGG - Intergenic
1085245600 11:75098345-75098367 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1085982803 11:81744748-81744770 CTGTCCACAGCTGCTGGCCCGGG + Intergenic
1086001087 11:81986897-81986919 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
1086305891 11:85481808-85481830 CCATCCACAGTGGCTGGCCTGGG - Intronic
1087407315 11:97745840-97745862 CCCTCCGCAGATGCTGGCCTGGG + Intergenic
1087486389 11:98763632-98763654 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
1089571197 11:119411433-119411455 AAGTCAACAGAGGCTGGGCATGG - Intergenic
1090245708 11:125214603-125214625 CAGACCTCAGAGGCTGGCCCAGG - Intronic
1090421022 11:126575023-126575045 CAGTCCACAGAGGGTGGTTATGG + Intronic
1090439717 11:126715369-126715391 ACCCCCTCAGAGGCTGGCCAGGG - Intronic
1091612507 12:2023267-2023289 CTGACCACTGAGGCTGTCCAGGG - Intronic
1091638144 12:2213728-2213750 CCGTCCACAGAGGGAAGGCACGG + Intronic
1092120597 12:6040981-6041003 GCGTCCTCACAGGCTGGCCCTGG - Intronic
1092135203 12:6142335-6142357 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1093443774 12:19230579-19230601 CCCTCCACAGCTGCTGGCCTGGG + Intronic
1093715523 12:22377045-22377067 CCCTCCGCAGCTGCTGGCCAGGG - Intronic
1094718194 12:33034153-33034175 CCCTCCACAGCCGCTGGCCTGGG + Intergenic
1095368896 12:41442575-41442597 CCATCCACAGCTGCTGGCGAAGG + Intronic
1095587411 12:43864032-43864054 CCCTCCACAGCTGCTGGCCCGGG - Intronic
1096474984 12:51903506-51903528 CAGTCAACATAGGCTGGGCACGG + Intergenic
1098541266 12:71661011-71661033 CCATCCACATTGGCTGGGCACGG + Intronic
1099204356 12:79711073-79711095 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1103760878 12:123249541-123249563 CCCTCCACAGCTGCTGGCCGGGG + Intronic
1104001305 12:124862553-124862575 CAGTCCAAAGAGGCAGGCCAAGG + Intronic
1104614514 12:130256876-130256898 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1104823845 12:131694410-131694432 CCGTGCACAGAGGCTGCACACGG + Intergenic
1104902686 12:132197774-132197796 CCTTCCCCAGAGGCTGACCTGGG + Exonic
1105245387 13:18645568-18645590 CCTTCTTCAGAGGCTGACCATGG + Intergenic
1105407808 13:20145981-20146003 CCGTCCTCAGAGCCAGGCCTAGG - Intronic
1105722175 13:23127710-23127732 CCCTCCACAGCCGCTGGCCTGGG - Intergenic
1105876682 13:24560927-24560949 CCCTCCACAGCCGCTGGCCCAGG + Intergenic
1105883482 13:24623495-24623517 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1106221327 13:27748536-27748558 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1108362303 13:49678531-49678553 CCCTCCACAGCTGCTGGCCCGGG + Intronic
1108858958 13:54829722-54829744 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1109124923 13:58505642-58505664 CCCTCCACAGGTGCTGGCCTGGG + Intergenic
1109201869 13:59440048-59440070 CCCTCCACAGCTGCTGGCCAGGG - Intergenic
1109638090 13:65149795-65149817 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1109854297 13:68107939-68107961 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1110495255 13:76160841-76160863 CTGCCCCCAGAGACTGGCCAGGG + Intergenic
1110497855 13:76190238-76190260 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1115118282 14:29909135-29909157 CCCTCCACAGCTGCTGGCCCAGG - Intronic
1115284253 14:31700684-31700706 CCCTCCACAGCTGCTGGCCCAGG - Intronic
1116656962 14:47665669-47665691 CCCTCCACAGCTGCTGGCCCAGG - Intronic
1120169684 14:81236231-81236253 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1121667641 14:95685315-95685337 TCCTCCACAGAAGCTGCCCAGGG + Intergenic
1122967842 14:105139538-105139560 CCATCCACATGGGCTGGCCATGG + Intergenic
1123500821 15:20878843-20878865 ACCTCCACAGAGGCTCGCCAGGG - Intergenic
1123558072 15:21452538-21452560 ACCTCCACAGAGGCTCGCCAGGG - Intergenic
1123594300 15:21889819-21889841 ACCTCCACAGAGGCTCGCCAGGG - Intergenic
1123787457 15:23687389-23687411 CCGCCCCCAGCCGCTGGCCAAGG - Intergenic
1123799141 15:23803052-23803074 CCCTCCACAGTCGCTGGCCTGGG - Intergenic
1124114856 15:26831401-26831423 CCCTCCGCAGCGGCTGGCCTGGG + Intronic
1125112218 15:36047093-36047115 CCCTCCGCAGCGGCTGGCCCGGG - Intergenic
1125500958 15:40240104-40240126 CCGTCCGGAGGGGCTGGCCAGGG + Intronic
1126706048 15:51406133-51406155 CCCTCCACAAAGGCTGGTTAGGG + Exonic
1126969231 15:54091044-54091066 CCTTCCACAGAAGCTGGGCGGGG + Intronic
1127916447 15:63459224-63459246 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1127917459 15:63466957-63466979 CCCTCCACAAAGGTGGGCCAGGG + Intergenic
1127984777 15:64061022-64061044 CCCTCCGCAGCGGCTGGCCCGGG - Intronic
1128768591 15:70265812-70265834 TCGTCCTCAGTGGCTGGTCATGG - Intergenic
1130132865 15:81158761-81158783 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1131058024 15:89387625-89387647 GCATGCACAGAGGCTGGCCTTGG + Intergenic
1131340865 15:91599301-91599323 GCATCCACAGTGGCTGCCCAGGG - Intergenic
1132315517 15:100887609-100887631 CCTTCCAGAGGGGCTCGCCATGG + Exonic
1202966422 15_KI270727v1_random:179710-179732 ACCTCCACAGAGGCTCGCCAGGG - Intergenic
1132578769 16:675776-675798 CTGTCCATAGAGCCTGGCCGGGG - Exonic
1132746740 16:1439384-1439406 CCCACCACCGAGGCTGCCCAGGG + Intronic
1132809978 16:1792846-1792868 CTGCCCTCAGAGGCTGGACAGGG + Intronic
1132833810 16:1942692-1942714 CCGGCCACAGGAGCTGGCCCTGG + Intronic
1132939144 16:2498448-2498470 CTGCCCACAGAGGCTGGAAATGG + Intronic
1132941426 16:2510313-2510335 CCCACCACAGAGGCAGGCCCTGG + Intronic
1133019883 16:2962757-2962779 CAGTCCACAGAGGATGTCCTAGG - Intergenic
1136163296 16:28435508-28435530 CCGTCCGCAGCTGCTGGCCCGGG - Intergenic
1136199669 16:28679479-28679501 CCGTCCGCAGCTGCTGGCCTGGG + Intergenic
1136216015 16:28793652-28793674 CCGTCCGCAGCTGCTGGCCCGGG + Intergenic
1138168837 16:54829955-54829977 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1141556283 16:84838749-84838771 CCGGCCGCAGAGGCTGGCACCGG + Intronic
1141596667 16:85101119-85101141 ACGGCCACAGTGGCTGCCCACGG - Intronic
1141799149 16:86295389-86295411 CTGGCCACAGATGCTGGCCACGG + Intergenic
1141799169 16:86295509-86295531 CTGGCCACAGATGCTGGCCATGG + Intergenic
1141799177 16:86295563-86295585 CAGCCCACAGATGCTGGCCATGG + Intergenic
1143119668 17:4598967-4598989 CCGGCCCCTGAGCCTGGCCAGGG + Intronic
1143205167 17:5136150-5136172 CAGGACACAGAGGGTGGCCATGG - Intronic
1143524267 17:7463210-7463232 CCCCCCACAGGGGCTGGCCGGGG - Exonic
1143631991 17:8144871-8144893 CCGTCCAGTGGGGCTGACCAAGG - Exonic
1143878788 17:10013941-10013963 CCAGCCACAGAGGGTGGCCCAGG - Intronic
1143941306 17:10545113-10545135 AGTTCAACAGAGGCTGGCCATGG - Intronic
1144876218 17:18398842-18398864 CAGGACACAGAGGGTGGCCACGG - Intergenic
1144946556 17:18972326-18972348 CATTCCACAGAGGCTGGCTGTGG - Intronic
1144999023 17:19290515-19290537 CCCTCAACAGAGGCCAGCCAAGG - Intronic
1145156010 17:20545578-20545600 CAGGACACAGAGGGTGGCCACGG + Intergenic
1145303509 17:21656728-21656750 GCGTCCCCAGAGTCAGGCCATGG + Intergenic
1146843475 17:36169646-36169668 CAGGACACAGAGGGTGGCCACGG + Intronic
1146855783 17:36257584-36257606 CAGGACACAGAGGGTGGCCACGG + Intronic
1146864837 17:36330791-36330813 CAGGACACAGAGGGTGGCCACGG - Intronic
1146871690 17:36381495-36381517 CAGGACACAGAGGGTGGCCACGG + Intronic
1146879049 17:36432577-36432599 CAGGACACAGAGGGTGGCCACGG + Intronic
1146882989 17:36453723-36453745 CAGGACACAGAGGGTGGCCACGG + Intergenic
1147067696 17:37931385-37931407 CAGGACACAGAGGGTGGCCACGG - Intronic
1147074576 17:37982119-37982141 CAGGACACAGAGGGTGGCCACGG + Intronic
1147079227 17:38010940-38010962 CAGGACACAGAGGGTGGCCACGG - Intronic
1147086099 17:38061658-38061680 CAGGACACAGAGGGTGGCCACGG + Intronic
1147095166 17:38134882-38134904 CAGGACACAGAGGGTGGCCACGG - Intergenic
1147102044 17:38185623-38185645 CAGGACACAGAGGGTGGCCACGG + Intergenic
1147878840 17:43641190-43641212 CCGTCCACACAGGCTTGACTGGG - Exonic
1148819685 17:50353434-50353456 GCGCCCTCAGTGGCTGGCCAGGG + Intronic
1148991250 17:51668910-51668932 CCCTCCACAGCTGCTGGCCCAGG - Intronic
1149770385 17:59316270-59316292 CAGGCCACAGAGGCCGGGCATGG + Intergenic
1149846636 17:60012134-60012156 CAGGACACAGAGGGTGGCCACGG + Intergenic
1150084982 17:62268708-62268730 CAGGACACAGAGGGTGGCCACGG + Intergenic
1151144882 17:72031255-72031277 CTGTCTGCAGAGGCTGGCAAAGG - Intergenic
1151930772 17:77230236-77230258 CCGTCCCCACAGGCCGGCCCGGG - Intergenic
1152228403 17:79103048-79103070 CCCTTCAGAGAGCCTGGCCAGGG - Intronic
1152666013 17:81570106-81570128 CCTTCCACAGCGGCTGGCGCTGG - Intronic
1152743323 17:82028104-82028126 CCTGTCACAGAGGCAGGCCAAGG + Exonic
1154443557 18:14414379-14414401 CCTTCTTCAGAGGCTGACCATGG - Intergenic
1154502441 18:15003535-15003557 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
1155250858 18:23951867-23951889 CCATCCACAGTGCCTGACCAGGG + Intronic
1155491765 18:26407002-26407024 CAGTCCGCTGAGGCTGGACAGGG - Intergenic
1155852282 18:30788583-30788605 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1156487777 18:37477520-37477542 CATTCTTCAGAGGCTGGCCAAGG - Intronic
1156651938 18:39235468-39235490 CCTTCCACAGCTGCTGGCCCAGG - Intergenic
1156943169 18:42795371-42795393 CCCTCCACAGCCGCTGGCCCGGG - Intronic
1158697259 18:59714314-59714336 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1159109804 18:64043110-64043132 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1159260482 18:66006176-66006198 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
1161958600 19:7509912-7509934 CAGCCCACAGAGGCAGGCCCCGG - Intronic
1162091090 19:8280579-8280601 CCCTCCACAGCTGCTGGCCCGGG + Intronic
1162093324 19:8295417-8295439 CCCTCCACAGCTGCTGGCCCGGG + Intronic
1162230146 19:9259652-9259674 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1162804553 19:13130366-13130388 CAGTGCAGAGAGGCTGGGCACGG - Intronic
1164649742 19:29883092-29883114 CCATCCACAGCGGCTGCCCACGG + Intergenic
1164698074 19:30261873-30261895 CCCTCCCCAGGGGATGGCCAAGG - Intronic
1164849127 19:31465947-31465969 GCCTCCACAAAGGCTGGGCATGG + Intergenic
1165055411 19:33173420-33173442 CTGGCCACAGAGGCTGTCCCTGG + Intronic
1166556094 19:43700645-43700667 CCGACAACAGTGTCTGGCCAGGG + Intergenic
1167261527 19:48461718-48461740 CCGTCCAATGGGCCTGGCCAGGG + Exonic
1167522139 19:49961275-49961297 CCCACCTCCGAGGCTGGCCAGGG - Intergenic
1167523242 19:49969450-49969472 CCCACCTCCGAGGCTGGCCAGGG + Intergenic
1168118123 19:54236873-54236895 TTGTCAACAGAGGCTGGCAAGGG + Intronic
1168435076 19:56310229-56310251 CCCTCCACACAGGCAGTCCAGGG - Intronic
925088698 2:1134944-1134966 CCCTCCGCAGCCGCTGGCCAGGG + Intronic
925320263 2:2960808-2960830 CTGTGAACAGAGGCTGGCCTCGG + Intergenic
925843802 2:8017823-8017845 CTTTCCTCAGAGACTGGCCAAGG - Intergenic
926006512 2:9377272-9377294 CTGTGCACAGAGGGTGGTCATGG - Intronic
926437668 2:12854293-12854315 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
927498024 2:23563717-23563739 CCGGCCACAGAGCCTGGCAGAGG + Intronic
928425640 2:31175538-31175560 CCTTCCACAGTGGCTGGCTCAGG - Intronic
928880575 2:36092380-36092402 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
932430900 2:71672995-71673017 CCAGCCTCAGAGGTTGGCCACGG - Intronic
934736277 2:96691435-96691457 CCCACCACAGGGCCTGGCCAAGG + Intergenic
935790301 2:106584528-106584550 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
935878363 2:107536312-107536334 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
936250811 2:110866944-110866966 GCTGCCCCAGAGGCTGGCCAGGG + Intronic
937608202 2:123826966-123826988 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
938116709 2:128607256-128607278 TTGTTCAGAGAGGCTGGCCAGGG - Intergenic
938126081 2:128672346-128672368 CCCTCCACAGCTGCTGGCCAGGG + Intergenic
938380992 2:130836698-130836720 CCGTCCACAGACCCGGCCCAGGG - Intergenic
938501616 2:131833707-131833729 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
938804026 2:134789395-134789417 CTGTCCCCAGAGGCTGACCCTGG - Intergenic
939745417 2:145960790-145960812 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
939869053 2:147507047-147507069 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
942317602 2:174709798-174709820 CCCTCCGCAGGGGCTGGCCCAGG + Intergenic
943443289 2:187951853-187951875 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
945869149 2:215208012-215208034 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
947466060 2:230347574-230347596 CTGGCCACTGAGGCTGGGCAGGG + Intronic
948169165 2:235887419-235887441 AGGTCTACAGAGGCTGGACATGG - Intronic
948415250 2:237798414-237798436 CCGCCCTCAGAGGCGGGACAGGG - Intronic
948610223 2:239162071-239162093 CAGCCCCCAGAGGGTGGCCACGG - Intronic
1170351817 20:15449700-15449722 ACATGCACAGAGGCTGGACATGG + Intronic
1170362831 20:15566191-15566213 CAATCCCCAGAGGCTGGGCACGG + Intronic
1171406645 20:24916180-24916202 CCGAACCCACAGGCTGGCCATGG + Intergenic
1172264791 20:33601606-33601628 CATTCCAAAGAAGCTGGCCAAGG - Intronic
1173831508 20:46091989-46092011 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1174092302 20:48059001-48059023 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1174480827 20:50830201-50830223 CCTGCCTCAGAGGTTGGCCAGGG - Intronic
1174639990 20:52035606-52035628 CCTTCTACAAAGGCTGGCCTGGG + Intergenic
1175862785 20:62159152-62159174 CTGCCCAGAGAGGCTGGCCCAGG - Intronic
1176273130 20:64246810-64246832 CCAGCCAGTGAGGCTGGCCAAGG + Intergenic
1176452531 21:6876859-6876881 CCTTCTTCAGAGGCTGACCATGG + Intergenic
1176671040 21:9735677-9735699 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1176830704 21:13741908-13741930 CCTTCTTCAGAGGCTGACCATGG + Intergenic
1177565827 21:22819061-22819083 CCCTCCGCAGCCGCTGGCCAGGG + Intergenic
1178716992 21:34974262-34974284 ACCTCCACACAGGCTGGCCAGGG + Intronic
1181800896 22:25347152-25347174 CCCTCCACAGGTGCTGGCCTGGG + Intergenic
1184039005 22:41932575-41932597 CACTCCACAGGGTCTGGCCAGGG + Intergenic
1184369588 22:44074169-44074191 TGGTCCTCTGAGGCTGGCCAAGG + Intronic
1184651082 22:45919755-45919777 TCCTCCCCAGAGCCTGGCCATGG - Intergenic
1184806581 22:46798512-46798534 CGTTCCACAGAGCCTGGCCACGG - Intronic
1184897929 22:47422952-47422974 TGGTCCGCAGTGGCTGGCCAGGG - Intergenic
1184943224 22:47783671-47783693 AGGTGCACAGAGGCTGCCCAGGG + Intergenic
1185347046 22:50314993-50315015 CCGTTCACCCAGGCTGGCCCAGG + Intronic
950600378 3:14029716-14029738 CCCTCCACAGCCGCTGGCCCGGG + Intronic
951024858 3:17817907-17817929 CCCTCCACAGCTGCTGGCCCAGG + Intronic
951323203 3:21271843-21271865 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
951415441 3:22417091-22417113 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
951730276 3:25803146-25803168 CCTTTAACAGAGGTTGGCCATGG - Intergenic
951951088 3:28200634-28200656 CCGTCCGCAGCCGCTGGCCCGGG + Intergenic
952453694 3:33453588-33453610 CCATCCACAGCTGCTGGCCTGGG - Intergenic
952763254 3:36934102-36934124 AGGTACACAGAGGCAGGCCAGGG + Intronic
953262607 3:41354249-41354271 CAGTCCACAGTGGCTGAGCAGGG + Intronic
954230562 3:49213662-49213684 CCCTCCACAGCTGCTGGCCCAGG + Intronic
954377244 3:50201654-50201676 CCCTCCACACTTGCTGGCCATGG - Intergenic
957419669 3:79951592-79951614 CCCTCCGCAGCCGCTGGCCAGGG + Intergenic
957556297 3:81767608-81767630 CCCTCCGCAGCCGCTGGCCAGGG + Intergenic
958419874 3:93917725-93917747 CCCTCCACAGCTGCTGGCCCGGG - Intronic
961098274 3:124176109-124176131 CAGACCAGAGAGGCTGGTCAGGG - Intronic
962467670 3:135675219-135675241 ACGTCCACAGAGGTGAGCCAAGG + Intergenic
963397880 3:144757021-144757043 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
963533265 3:146497437-146497459 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
964393784 3:156224143-156224165 CCCTCCACAGCTGCTGGCCTGGG + Intronic
964477908 3:157113026-157113048 CTTTCCACAGAGGCTGAACATGG - Intergenic
964982503 3:162703146-162703168 CTGTCCACAGCTGCTGGCCCTGG + Intergenic
965586978 3:170327562-170327584 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
966425475 3:179775736-179775758 CCCTCCACAGATGCTGGCCTGGG + Intronic
967448505 3:189596263-189596285 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
967499154 3:190177270-190177292 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
968653367 4:1768574-1768596 CGGTCCACAGGGGATGGCCTGGG + Intergenic
968744570 4:2353019-2353041 CCACCCACAGAGGCTGTCCCTGG + Intronic
969303157 4:6309246-6309268 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
969440743 4:7215268-7215290 CCCTCCACAGCCGCTGGCCCGGG - Intronic
969655834 4:8498017-8498039 GAGTCCACAGAGGCTGGGGAGGG - Intergenic
969869850 4:10097776-10097798 CCGGCCATACCGGCTGGCCACGG - Exonic
970408648 4:15786956-15786978 CCCTCCACAGCTGCTGGCCTGGG + Intronic
971563566 4:28112919-28112941 CCCTCCACAGCCGCTGGCCCAGG - Intergenic
972344639 4:38182703-38182725 CCCTCCACAGCTGCTGGCCCTGG - Intergenic
972851216 4:43053184-43053206 CCTTCCAGAGTGGCTGGTCAAGG - Intergenic
973135252 4:46698997-46699019 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
973890336 4:55361820-55361842 CCTTCCAAAGAGGATGTCCACGG - Intronic
974061932 4:57043190-57043212 CCGTCCGCAGAGGAGGGTCATGG + Intronic
974807561 4:66899680-66899702 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
975028047 4:69576555-69576577 CCCTCCACAGCTGCTGGCCCCGG + Intergenic
977206522 4:94169984-94170006 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
977400074 4:96521253-96521275 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
977416663 4:96742658-96742680 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
978254885 4:106681675-106681697 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
978929800 4:114296373-114296395 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
979865216 4:125745131-125745153 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
980595436 4:134948372-134948394 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
981146722 4:141333239-141333261 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
982768935 4:159378237-159378259 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
983425703 4:167581699-167581721 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
983835395 4:172377757-172377779 CCCTCCGCAGACGCTGGCCCAGG + Intronic
983843181 4:172482093-172482115 CCCTCCACAGCTGCTGGCCCGGG + Intronic
984192836 4:176625386-176625408 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
984918102 4:184741346-184741368 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985590888 5:764501-764523 CCCTCCACAGCTGCTGGCCTAGG - Intronic
985733887 5:1566235-1566257 CCATCCTCCGGGGCTGGCCATGG - Intergenic
986661747 5:10065629-10065651 CCCTCCACAGCTGCTGGCCAGGG - Intergenic
986811201 5:11361444-11361466 ACCTTCACACAGGCTGGCCATGG - Intronic
987358224 5:17083590-17083612 CCCTCCACAGCCGCTGGCCCGGG - Intronic
989375462 5:40755886-40755908 CAGTCCACAGAAGCGGGCAAAGG + Exonic
989777380 5:45225751-45225773 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
990418968 5:55613491-55613513 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
992050363 5:72935378-72935400 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
992086306 5:73281165-73281187 CCGCCCACAGAGGGTGGCAAGGG - Intergenic
993770289 5:91917416-91917438 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
994167011 5:96618642-96618664 CCCTCCACAGCTGCTGGCCCAGG - Intronic
994251518 5:97542101-97542123 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
994768639 5:103954035-103954057 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
995529134 5:113075175-113075197 CCCTCCACAGCTGCTGGCCCGGG - Intronic
996388808 5:122937996-122938018 TGGTCAACAGAGGCTGGGCAAGG - Intronic
997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG + Intronic
998117538 5:139549483-139549505 CCCTCCACAGCGGCTGGCCAGGG - Intronic
998544441 5:143014644-143014666 CAGTCTACAGAGGCTGCCCAGGG - Intronic
999855281 5:155586972-155586994 CCCTCCACAGCCGCTGGCCTGGG + Intergenic
1000066035 5:157693978-157694000 CCCTCCGCAGACGCTGGCCTGGG - Intergenic
1000902485 5:166927168-166927190 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1001266352 5:170277274-170277296 CCGTTCTCATAGGCAGGCCAGGG - Intronic
1002612784 5:180432306-180432328 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1002681633 5:180969691-180969713 CCCTCCACAGCTGCTGGCCTGGG + Intergenic
1002758022 6:179733-179755 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1003495001 6:6655977-6655999 GCGTACACAGAGTCTAGCCAGGG - Intergenic
1003845730 6:10171864-10171886 CCCTCCACAGCCGCTGGCCCGGG - Intronic
1003862793 6:10337551-10337573 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1005059287 6:21761298-21761320 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1005097448 6:22132795-22132817 CAGTCCTCAGAGGCTGGGCTTGG - Intergenic
1005114281 6:22318635-22318657 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
1006005772 6:31000605-31000627 CCGTCCGCAGCTGCTGGCCCGGG - Intergenic
1006351102 6:33521728-33521750 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1006370078 6:33638835-33638857 AGGCCCACAGGGGCTGGCCAAGG + Intronic
1007032220 6:38639358-38639380 TCCTACTCAGAGGCTGGCCAGGG + Intronic
1009559854 6:65225423-65225445 CAATCCACATAGGCTGGGCACGG + Intronic
1009872267 6:69467342-69467364 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1013410778 6:109881363-109881385 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1014788472 6:125644592-125644614 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1015912750 6:138185090-138185112 GCTTCCAAGGAGGCTGGCCACGG + Intronic
1016172930 6:141041792-141041814 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
1017298986 6:152834484-152834506 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1017537373 6:155363209-155363231 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1018000282 6:159572686-159572708 GTGTCCACAGAGGATGCCCAGGG - Intergenic
1019086227 6:169480176-169480198 CCTTCCACAGGTGCTGGCCCAGG - Intronic
1019539781 7:1546445-1546467 GGGTCCACACAGGCTGGCCGGGG - Exonic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1019690713 7:2409817-2409839 CTGTGCACAGAGGCAGGCGAGGG - Intronic
1020662200 7:10995772-10995794 CCCTCCACAGCTGCTGGCCCAGG + Intronic
1021359409 7:19692469-19692491 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
1022459849 7:30594882-30594904 CTGTCCAGAGAGGGTGGCGACGG - Exonic
1025290535 7:57717122-57717144 CCTTCCACAGAGCCAGGTCATGG + Intergenic
1026877056 7:73885798-73885820 CAGACCACTGAGGCTGGGCATGG + Intergenic
1026895911 7:74010035-74010057 CCGTCCACACAGGCTGTCTGTGG - Intergenic
1027868099 7:83673458-83673480 CCGTCCGCAGCCGCTGGCCCGGG - Intergenic
1028989502 7:97034479-97034501 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1029472521 7:100763636-100763658 CCTCCCACAGTGCCTGGCCAGGG + Intronic
1029906780 7:104100712-104100734 CCCTGCACAGAGCCTGGCCAAGG + Intergenic
1031213357 7:118858918-118858940 CCCTCCACAGCTGCTGGCCCCGG + Intergenic
1031409207 7:121421869-121421891 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1031513309 7:122674049-122674071 CCCTCCACAGCTGCTGGCCCAGG + Intronic
1032091568 7:128914133-128914155 CCCCTCACAGAGGCTGCCCAGGG - Intergenic
1032339648 7:131058903-131058925 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1034869374 7:154670148-154670170 CCCTCCGCAGAGGCTGGGCACGG - Intronic
1035223576 7:157421022-157421044 CCGTCCACAGAGGCAGCCTTGGG - Intergenic
1035281692 7:157782451-157782473 CCCTCCACAGAGGGGGTCCAGGG + Intronic
1035463900 7:159063360-159063382 CCCTCCACAGCTGCTGGCCCGGG + Intronic
1035767449 8:2118730-2118752 CAGGACCCAGAGGCTGGCCATGG + Intronic
1035843074 8:2833368-2833390 CCGTCAACAGAAGCTGGCCCAGG + Intergenic
1036693773 8:10961422-10961444 GCATCCTCAGAGGCTGGCTAGGG + Intronic
1037143074 8:15540582-15540604 CCGCCCACAGGGGAAGGCCAAGG - Intronic
1039069112 8:33634053-33634075 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1040059581 8:43093040-43093062 CCCTCCGCGGAGGCTTGCCAAGG + Intergenic
1040081557 8:43291330-43291352 CCGTGCCCGGATGCTGGCCAGGG - Intergenic
1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG + Intergenic
1042948759 8:74179750-74179772 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1043670640 8:82880828-82880850 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1044075821 8:87820974-87820996 CCCTCCACAGCCGCTGGCCCGGG - Intergenic
1044441646 8:92230915-92230937 CCCTCCGCAGATGCTGGCCCGGG - Intergenic
1044598372 8:93980049-93980071 ACATCCACACAGGATGGCCAGGG - Intergenic
1045407387 8:101880219-101880241 CCCTCCACAGCTGCTGGCCCTGG + Intronic
1045678411 8:104633105-104633127 CCCTCCACAGCTGCTGGCCCGGG + Intronic
1046660954 8:116948059-116948081 CCGGCCGCAGAGGCTGCACAAGG - Intergenic
1048112853 8:131487170-131487192 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1048204315 8:132403329-132403351 CCATCCACAGGGGCTGGGGATGG - Intronic
1048479697 8:134777454-134777476 CCATCCACACAGTTTGGCCAAGG - Intergenic
1048736615 8:137508999-137509021 CTGTCCTGAGGGGCTGGCCATGG + Intergenic
1048757499 8:137755341-137755363 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1049498432 8:142947618-142947640 CCGTGCAGACAGGGTGGCCAGGG - Intergenic
1049798397 8:144506721-144506743 CCGTCCACAGGAGCTGGGCCTGG + Exonic
1051336631 9:16071536-16071558 CTGTCCCCAGTGCCTGGCCATGG + Intergenic
1051929059 9:22363693-22363715 CCCTCCGCAGCTGCTGGCCAGGG + Intergenic
1053027286 9:34740457-34740479 CCCTCCACAGCCGCTGGCCTGGG + Intergenic
1056716403 9:89034450-89034472 GCGCCTACAGAGGCTGACCAGGG - Intronic
1056799436 9:89681230-89681252 CCCTCCACAGCTGCTGGCCAGGG - Intergenic
1057318916 9:93994115-93994137 CAGTCCACAGAGGCTGTGCATGG - Intergenic
1058365183 9:104200734-104200756 CCCTCCACAGCTGCTGGCCCAGG - Intergenic
1058786495 9:108393653-108393675 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1058799364 9:108530284-108530306 CCCTCCACAGCTGCTGGCCTGGG - Intergenic
1061200144 9:129133254-129133276 CCAGCCACAGAGGCAGGCCCTGG + Intronic
1061483826 9:130910261-130910283 CCCTCCACAGCCGCTGGCCCAGG - Intronic
1062325191 9:136009494-136009516 GCGTCCACAGTGCCTGCCCATGG + Exonic
1062451748 9:136618647-136618669 GCGCCCACGGAGACTGGCCACGG - Intergenic
1062498056 9:136840842-136840864 CTGTTTACAGAGGCTGGGCAGGG + Exonic
1062520427 9:136955380-136955402 CCTTCAACAGACGCTGGCCTGGG - Exonic
1062543747 9:137052840-137052862 AGGTCCACCGAGGCTGGCCGTGG + Intronic
1203516650 Un_GL000213v1:7656-7678 CCTTCTTCAGAGGCTGACCATGG - Intergenic
1186071288 X:5824082-5824104 CCTTCCACAGAGGCTGCCCTGGG + Intergenic
1186152596 X:6690728-6690750 CCCTCCACAGCCGCTGGCCCGGG + Intergenic
1187684563 X:21803388-21803410 CTGTCCATAGATGCTGCCCATGG - Intergenic
1189467119 X:41285930-41285952 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1192022460 X:67408800-67408822 CCGTCCACAGCTGCTGGGCTGGG - Intergenic
1192225815 X:69226994-69227016 CCGTCCTCAGAGTCTGGTCCAGG - Intergenic
1194204462 X:90995545-90995567 CCCTCCACAGCTGCTGGCCCGGG - Intergenic
1194340457 X:92699702-92699724 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1195896372 X:109749542-109749564 CCCTCCGCAGATGCTGGCCCGGG + Intergenic
1196763949 X:119225998-119226020 CTTGCCACAGAGGATGGCCAGGG - Intergenic
1196860866 X:120026007-120026029 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1197152704 X:123237499-123237521 AAGTCCTCAGAGGTTGGCCAAGG - Intronic
1197177431 X:123500642-123500664 CCATCCCCTGAGGCTTGCCACGG - Intergenic
1198299983 X:135325593-135325615 CCCTCCACAGCCGCTGGCCCGGG - Intronic
1199094847 X:143726455-143726477 CCCTCCACAGCTGCTGGCCCAGG + Intergenic
1200648816 Y:5816438-5816460 CCCTCCACAGCTGCTGGCCCGGG + Intergenic
1201260953 Y:12158630-12158652 CCAGCCAGCGAGGCTGGCCATGG - Intergenic
1201707161 Y:16949995-16950017 CAGCCCACAGAGGCTAGGCAAGG + Intergenic