ID: 997625246

View in Genome Browser
Species Human (GRCh38)
Location 5:135326915-135326937
Sequence CCGTCCACAGAGGCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 413}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997625239_997625246 1 Left 997625239 5:135326891-135326913 CCCCAAAACTGGCTTCAAGCTGT No data
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625238_997625246 2 Left 997625238 5:135326890-135326912 CCCCCAAAACTGGCTTCAAGCTG No data
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625236_997625246 13 Left 997625236 5:135326879-135326901 CCGGGACACATCCCCCAAAACTG 0: 1
1: 0
2: 0
3: 16
4: 190
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625235_997625246 14 Left 997625235 5:135326878-135326900 CCCGGGACACATCCCCCAAAACT 0: 1
1: 0
2: 4
3: 13
4: 194
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625240_997625246 0 Left 997625240 5:135326892-135326914 CCCAAAACTGGCTTCAAGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625234_997625246 19 Left 997625234 5:135326873-135326895 CCACACCCGGGACACATCCCCCA 0: 1
1: 0
2: 1
3: 20
4: 207
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413
997625241_997625246 -1 Left 997625241 5:135326893-135326915 CCAAAACTGGCTTCAAGCTGTAC 0: 1
1: 0
2: 1
3: 12
4: 93
Right 997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997625246 Original CRISPR CCGTCCACAGAGGCTGGCCA GGG Intronic