ID: 997625300

View in Genome Browser
Species Human (GRCh38)
Location 5:135327129-135327151
Sequence CGTCCCAGAGAAGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997625295_997625300 0 Left 997625295 5:135327106-135327128 CCGAGCCGGGCTGCAGGGAGGCC 0: 1
1: 0
2: 2
3: 45
4: 353
Right 997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG No data
997625296_997625300 -5 Left 997625296 5:135327111-135327133 CCGGGCTGCAGGGAGGCCCGTCC 0: 1
1: 0
2: 1
3: 46
4: 290
Right 997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997625300 Original CRISPR CGTCCCAGAGAAGCCCGCGC GGG Intronic
No off target data available for this crispr