ID: 997628109

View in Genome Browser
Species Human (GRCh38)
Location 5:135345101-135345123
Sequence CCACTTCTGTTTTACCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997628109_997628115 23 Left 997628109 5:135345101-135345123 CCTTGCAGGTAAAACAGAAGTGG 0: 1
1: 0
2: 1
3: 22
4: 188
Right 997628115 5:135345147-135345169 ATCAGCAAAGGGAATCCTACTGG 0: 1
1: 0
2: 2
3: 7
4: 108
997628109_997628112 -5 Left 997628109 5:135345101-135345123 CCTTGCAGGTAAAACAGAAGTGG 0: 1
1: 0
2: 1
3: 22
4: 188
Right 997628112 5:135345119-135345141 AGTGGCAGAGCAGAGGTCAAAGG 0: 1
1: 0
2: 1
3: 33
4: 345
997628109_997628114 12 Left 997628109 5:135345101-135345123 CCTTGCAGGTAAAACAGAAGTGG 0: 1
1: 0
2: 1
3: 22
4: 188
Right 997628114 5:135345136-135345158 CAAAGGCACAGATCAGCAAAGGG 0: 1
1: 0
2: 1
3: 37
4: 401
997628109_997628113 11 Left 997628109 5:135345101-135345123 CCTTGCAGGTAAAACAGAAGTGG 0: 1
1: 0
2: 1
3: 22
4: 188
Right 997628113 5:135345135-135345157 TCAAAGGCACAGATCAGCAAAGG 0: 1
1: 0
2: 3
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997628109 Original CRISPR CCACTTCTGTTTTACCTGCA AGG (reversed) Intronic
908311112 1:62885261-62885283 CCACTTTTTTTTTAACAGCATGG - Intergenic
912090838 1:106073387-106073409 TCACTTCTGTTTTTACTGTATGG - Intergenic
912392470 1:109313685-109313707 CCACTTCTGTGTGTTCTGCATGG - Exonic
912412775 1:109489802-109489824 CCTCTTCTGATTGCCCTGCAGGG + Intronic
913465165 1:119133055-119133077 CCACCTCTCCTCTACCTGCAGGG + Intronic
916484381 1:165245100-165245122 CAACTTCTATTTTAGATGCAGGG + Intronic
920039934 1:203089013-203089035 CTACTTCTGTGTGCCCTGCAGGG + Intergenic
920821034 1:209381048-209381070 CAACTTCTGCTATACCTGTAAGG - Intergenic
921949653 1:220915912-220915934 CCACTTCTATTTTAACAGAATGG + Intergenic
923222343 1:231906768-231906790 CAGCTCCTGTTTTACCTTCAGGG - Intronic
924843293 1:247737528-247737550 CCTCCTCTGTTTGACCTGCTGGG + Intergenic
1062872830 10:921472-921494 CCACTTCTTTCTTTCCTGTAAGG + Intronic
1063000099 10:1909228-1909250 CCACCTCTGTCTATCCTGCATGG + Intergenic
1063651628 10:7943519-7943541 CCAGTTCTGTTCTAGCTGCCAGG + Intronic
1063653638 10:7965063-7965085 CAACTTCTTCTTTACCTCCACGG - Exonic
1063681525 10:8192629-8192651 CCACATATGTTTTATTTGCATGG - Intergenic
1063936312 10:11082157-11082179 CCATCTCTGCTTTACCTCCAGGG + Intronic
1064054962 10:12089456-12089478 CCACTTCTGTTTTCCTTGCATGG + Intronic
1065739851 10:28787429-28787451 CCACTTTTGTTTTAGGTTCAGGG + Intergenic
1066578873 10:36858168-36858190 CCAATTCTGCTTTTCCTGCTAGG - Intergenic
1067086167 10:43239669-43239691 CCATTGCTGTTTTCCCTCCAGGG - Intronic
1067327080 10:45279708-45279730 ACCCTTCTGTTTTATCTGCTTGG + Intergenic
1068374494 10:56160825-56160847 CCAAATCTGTTTTACTTGAAAGG + Intergenic
1068414069 10:56694111-56694133 CAACTTCTGTTTTAGCTTCAAGG - Intergenic
1070418282 10:76210398-76210420 ACACTTCTTTTTTTCCTGCCTGG + Intronic
1075588447 10:123674302-123674324 GCAGGTGTGTTTTACCTGCAAGG - Intronic
1075590477 10:123687648-123687670 CCATCTCTGTTTTACATGCAAGG - Intronic
1076823795 10:132957208-132957230 CCACTCCTGCTTTGCCTGCCTGG + Intergenic
1077049911 11:561918-561940 CCACTTCAGCTCTACCTGCCCGG - Intronic
1077218166 11:1403729-1403751 CCACTTCTGTCTCACCAGCATGG - Intronic
1078620140 11:12899683-12899705 CAGCTTCTGTCTTACCTGCCAGG + Intronic
1078632593 11:13016816-13016838 CCATTATTTTTTTACCTGCATGG + Intergenic
1079620475 11:22548333-22548355 ACATTTCTGTATTACCTGCATGG - Intergenic
1079931256 11:26565061-26565083 TCTCTTCTGTTTTTCCAGCATGG + Intronic
1080490557 11:32759107-32759129 CCTCTTCTGTTCTATCTTCATGG + Intronic
1081965405 11:47166253-47166275 CCACTTCAGCCTCACCTGCAAGG + Exonic
1083292786 11:61699200-61699222 CCAGTTCTATTCTACCAGCAGGG - Intronic
1083479540 11:62934670-62934692 CCACTTCAGTCTTTCCTGGAAGG - Intergenic
1083926391 11:65809551-65809573 CCACTTGTTTTTTTCCTTCATGG - Intergenic
1086042895 11:82500215-82500237 CCAGTTGTGTTTTACCACCAGGG - Intergenic
1086751891 11:90506854-90506876 GCATTTCTGTTTTACCTACATGG + Intergenic
1092191802 12:6526649-6526671 CAGCTTCTGTTCTCCCTGCAGGG + Intronic
1096051118 12:48608951-48608973 CAACTTTCGTTTTACCTTCAGGG + Intergenic
1097776523 12:63652912-63652934 CAACTTCTATTTTACGTTCATGG - Intronic
1098575038 12:72031500-72031522 CTACTTCTGTTTATTCTGCAGGG + Exonic
1099528081 12:83740821-83740843 CCTCTTCTGTTTGCCCTCCATGG - Intergenic
1100698949 12:97125592-97125614 CCACTTCTGTTTTTCCTCTATGG - Intergenic
1102519370 12:113469239-113469261 CCTCAACTGTTTCACCTGCATGG - Exonic
1109233338 13:59785743-59785765 CCACTTCTAGCTTAGCTGCAGGG - Intronic
1109929022 13:69187972-69187994 CTTTTTCTGTTTTACCTACAGGG - Intergenic
1113978187 13:114248246-114248268 CCAATTCTGTTTTATTTGCACGG - Intronic
1116239813 14:42325726-42325748 TAACTTCTGTTTTAACTTCAGGG + Intergenic
1116939140 14:50772934-50772956 CTGCTTATTTTTTACCTGCATGG + Exonic
1117457522 14:55912836-55912858 CCACCCCTTTTTTACCTTCAGGG + Intergenic
1118727693 14:68640903-68640925 CCACTTCTGCTTTAACTTTATGG - Intronic
1121203879 14:92144591-92144613 ACACTTCTGTTTTAGTTGCCTGG + Intronic
1124552624 15:30695639-30695661 CCACTTCTGTTCTATCTCCCAGG + Intronic
1124678619 15:31710029-31710051 CCACTTCTGTTCTATCTCCCAGG - Intronic
1124714199 15:32044148-32044170 GCTCTTTTGTTTTACCTGCTTGG + Intronic
1126424354 15:48510652-48510674 CCAATTCTGGTTTACGTGCAGGG + Intronic
1127707008 15:61557297-61557319 CAACTTCTGTTTTACATGCTGGG - Intergenic
1127824184 15:62689702-62689724 CCACTTCTTTCTTACCTCCATGG + Intronic
1127992082 15:64127036-64127058 CCACTTCTATGTTATATGCAGGG - Intronic
1128402742 15:67300944-67300966 CAATTACTGTTTTACCTACATGG - Intronic
1129292675 15:74580429-74580451 ACACTTCTGTTTCACCTCCTAGG - Intronic
1129678439 15:77644711-77644733 CCACTTCTGTGTTTGCTGGAGGG - Intronic
1130712584 15:86298485-86298507 CCATTTCTGATTTACAGGCATGG - Intronic
1130765834 15:86870044-86870066 CCACTTCTATTTAGACTGCAGGG + Intronic
1131059229 15:89394343-89394365 CTACTTCTGTTTGCTCTGCATGG + Intergenic
1131242315 15:90757492-90757514 TTACTTCTGTTTTCTCTGCAAGG - Intronic
1133423666 16:5668741-5668763 CCACTTTTGTTTTAGGTGCCTGG + Intergenic
1134907141 16:17989668-17989690 CCACCTCTGTTTTGCCTGTCTGG + Intergenic
1135136183 16:19886304-19886326 CCACTCCTGGTTTATTTGCATGG + Intergenic
1135937653 16:26794788-26794810 CCAATTCTTTTTTTCCTCCATGG + Intergenic
1137467141 16:48720168-48720190 CCTCTTCTTTTATACCTGCTGGG - Intergenic
1141420423 16:83911641-83911663 CCATTTCTGTTTTTCCTAAATGG - Intronic
1142873368 17:2835904-2835926 ACACTCCTGTTTTATCTGCTGGG + Intronic
1144573179 17:16413323-16413345 CCTCTTCTGTTCCACCTGCCAGG - Intergenic
1144684939 17:17219836-17219858 CCACTTTTGTTTTAGCTTGAGGG + Intronic
1154967081 18:21370106-21370128 GCACTTCTGTTTTGAATGCATGG + Intronic
1155354947 18:24943012-24943034 CCCCTTCTGCTTTACCTACGAGG + Intergenic
1155364330 18:25035253-25035275 CCACTCCCCTTTTCCCTGCAGGG - Intergenic
1156091976 18:33482454-33482476 CCACTTTTGTTTTAGGTTCAAGG + Intergenic
1156474909 18:37399360-37399382 CCCCTTCTGTTTTTCCTCCTTGG + Intronic
1157474944 18:48017692-48017714 CCACTTTTGTCTTTCCTGTATGG - Intergenic
1157805388 18:50654174-50654196 CCACTTACTTTCTACCTGCAGGG - Intronic
1162369994 19:10272841-10272863 CCCCTTCTTTCTTACCTGCAAGG + Intronic
1164591609 19:29510695-29510717 CCACCTCTGTTCAGCCTGCATGG - Intergenic
1164716305 19:30392961-30392983 CCACTTCTGTATGATCTGTATGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925418525 2:3691137-3691159 CCACTTCTTTTTGGCCTGTATGG + Intronic
926048872 2:9730392-9730414 CTTCTTCTGTTTTGCCTGGACGG + Intergenic
926578770 2:14612002-14612024 CCAATTCTGTGCTAGCTGCAGGG + Intergenic
928663630 2:33528745-33528767 CCACTTCTGCTTTATTTGAAGGG - Intronic
931666975 2:64616639-64616661 CCAGTTCTGGTTTAGCTGCTGGG - Intergenic
932936872 2:76113689-76113711 GCACATCTGATTTACCTGGAGGG + Intergenic
933581553 2:84132416-84132438 TCAATTCTATTTTACCTGGAAGG - Intergenic
934686488 2:96325493-96325515 CCACTGCTTTTTTCCCGGCAGGG - Intronic
938142439 2:128807459-128807481 CCACTTCTTTCTGACCTCCATGG + Intergenic
939549188 2:143592506-143592528 CCAATTCTCTTTCACATGCATGG - Intronic
940478174 2:154192435-154192457 CCACTCCTGTATCACCTACATGG + Intronic
941177455 2:162216154-162216176 TCATTTCAATTTTACCTGCAGGG + Intronic
943053563 2:182946576-182946598 CAACTTCTATTTTACGTTCAGGG - Intronic
944833056 2:203551787-203551809 CCAGTTCTCTTTTTCCTCCAGGG + Intergenic
945157107 2:206850375-206850397 CTATTACTGTTTTACCTGTAAGG + Intergenic
945827302 2:214738554-214738576 ATATTTCTGTTTTAGCTGCATGG + Intronic
947968264 2:234300587-234300609 GCACTTCTGCTTTGCTTGCACGG - Intergenic
948339966 2:237241876-237241898 CCACTTCTGTGCTACCAGCTTGG - Intergenic
1168958188 20:1849240-1849262 CCACTTCTCTGTCACCTCCAGGG + Intergenic
1169354325 20:4894796-4894818 ACACATCTGTTTCACCTTCATGG + Intronic
1169705815 20:8503445-8503467 TCACTTCTCTCTTACTTGCAGGG + Intronic
1170507944 20:17047888-17047910 CCTCTTTTGTGTTTCCTGCAGGG - Intergenic
1172288592 20:33758701-33758723 CCACTTGTCTTTCAGCTGCAGGG + Exonic
1172732381 20:37098784-37098806 CCACTTTAGTTTTTCCTCCAAGG - Intergenic
1176008779 20:62880792-62880814 CCCCCTCTGTTTCACCTGCAGGG + Exonic
1176042048 20:63071045-63071067 GCATCTCTGTTTTACCAGCAGGG - Intergenic
1179171758 21:38978414-38978436 CAACTTCTATTTTAGATGCAGGG + Intergenic
1180229150 21:46416048-46416070 CCTGTTCTGTTTCACCTGCAGGG + Exonic
1184473177 22:44707315-44707337 CCACTTCAGCTCTGCCTGCAGGG - Intronic
1184695762 22:46138275-46138297 TCACTTCTGTTTTTCCTTTAAGG - Intergenic
952481133 3:33762646-33762668 CCACTTCCTTTTGGCCTGCATGG + Intergenic
952733552 3:36665348-36665370 CCACTTCTCTTTTTACTGGAAGG - Intergenic
952921242 3:38285266-38285288 CCACTCCTGCTCTTCCTGCAGGG - Intronic
954725644 3:52606771-52606793 ACAGGTCTCTTTTACCTGCAAGG + Intronic
955188163 3:56734569-56734591 CCATTTTTGTTTTAGATGCAGGG - Intronic
955433805 3:58877996-58878018 CCACGTATGTGTTACCTGCCTGG - Intronic
955700056 3:61673216-61673238 CAATTTTTGTTTTACATGCAGGG - Intronic
956557316 3:70538251-70538273 TCACTGCTGATTTACCTGCTTGG + Intergenic
958586152 3:96091015-96091037 CCACTTCTGCTTGTCCTCCATGG - Intergenic
962318996 3:134375609-134375631 CCACTTCTGTGGCTCCTGCATGG + Intergenic
963859120 3:150288854-150288876 CCACTTCTCATTTACCAGCTGGG + Intergenic
963998817 3:151742956-151742978 ACACTTTTGTTTTACATGGAAGG + Intronic
967623098 3:191658914-191658936 CCACTGCTGTTTTGCCACCATGG + Intergenic
970867803 4:20779415-20779437 CCACTTCTCTATTACTTGCTGGG - Intronic
972656667 4:41070106-41070128 CCACTTCAGTTTAACCTGCTGGG + Intronic
975129490 4:70818452-70818474 CTACTTCTGTGTTACTTGAAGGG - Exonic
977110723 4:92950804-92950826 CTTCTTCTCTTTTACCTGGAAGG - Intronic
978227747 4:106358374-106358396 CCTCTTCTATTTTTTCTGCATGG + Intergenic
979560647 4:122097747-122097769 CCACTGCTCTTATACATGCATGG + Intergenic
980265308 4:130507376-130507398 CCCCTTCTTTCTGACCTGCAAGG + Intergenic
980634260 4:135478280-135478302 GCAGTTCTGTTTCACCTCCATGG - Intergenic
980734990 4:136873244-136873266 TCACTCCAGATTTACCTGCATGG + Intergenic
981085278 4:140676932-140676954 TTACATCTGTTTTACCAGCAAGG - Exonic
981393017 4:144214468-144214490 CTACTTCTATCTTTCCTGCAGGG + Intergenic
983792653 4:171816167-171816189 CCTTTCCTGTTTTACCAGCATGG - Intronic
984711933 4:182893113-182893135 TCACTTCTTTTATACCTGTAAGG + Exonic
985138169 4:186810819-186810841 ACACTACTGTTTTACCTCCTGGG - Intergenic
985982485 5:3482537-3482559 AGACTTCTGTTTTAACTGTAGGG - Intergenic
987075560 5:14379036-14379058 TCACTTCTGTTTTGCCTTAATGG + Intronic
987206519 5:15632984-15633006 CAACTTTTGTTTTAGCTTCAGGG - Intronic
988474566 5:31572472-31572494 CCACTTCTTTTTTACATGAAGGG - Intergenic
990134080 5:52624145-52624167 CAACTTCTATTTTACGTTCAGGG + Intergenic
990175869 5:53107782-53107804 CCCATTCTGCTTTACCTGGAGGG - Intronic
990875426 5:60479005-60479027 CCACCTCTGTTTTACAGGCAAGG + Intronic
991413896 5:66371614-66371636 CCACTGCTGTTTCACCTGCTGGG + Intergenic
992350737 5:75926488-75926510 CCATTTTTGTTTTTCCTGCTCGG + Intergenic
992355309 5:75976020-75976042 CCATTGCTGTTATTCCTGCACGG - Intergenic
992433591 5:76733405-76733427 CCACTGCTGTTATAACTGCTGGG - Exonic
994125542 5:96166158-96166180 TCACATCTGTTTTATCTGCAGGG - Intergenic
995451960 5:112311942-112311964 CCACTTCTTGTTTACCTGTTTGG - Intronic
997628109 5:135345101-135345123 CCACTTCTGTTTTACCTGCAAGG - Intronic
997633842 5:135390127-135390149 CCACTTCTTTTCTCCCTGCCTGG + Intronic
998367744 5:141641630-141641652 CCAGTCCTGTTTTGTCTGCAGGG - Intronic
1002662464 5:180801046-180801068 CCACCTCGGTTTTAGCTGAAGGG - Intronic
1002778883 6:351580-351602 TTAGTTCTGTTTTGCCTGCACGG + Intergenic
1002873422 6:1188485-1188507 CCAGCTCTCATTTACCTGCAAGG - Intergenic
1004637690 6:17484684-17484706 CCACCTCTGTATTGCTTGCACGG - Intronic
1005260016 6:24049069-24049091 GCACTGCTGTTGTCCCTGCAAGG + Intergenic
1006997116 6:38271450-38271472 ACACTTCACTTTTACCTGTATGG + Intronic
1008304921 6:49889294-49889316 CAATTTCTGTTTTTGCTGCAGGG + Intergenic
1009818706 6:68771798-68771820 CATCTTCTGTCTGACCTGCAAGG + Intronic
1010758975 6:79699874-79699896 CCACTTCTCTTTAAGCTGCCTGG + Exonic
1010864320 6:80954657-80954679 CAAATTCTGTTTCTCCTGCAGGG - Intergenic
1011362029 6:86537683-86537705 CCACTTCTGATTTACATGTATGG - Intergenic
1012984181 6:105857414-105857436 ATAATTCTGTTTTACCTTCAAGG - Intergenic
1013290268 6:108713334-108713356 CCACTCCTGAGTGACCTGCAGGG - Intergenic
1013651048 6:112194887-112194909 CCAGTTCTGTTTTCCTTGGATGG - Intronic
1015966459 6:138699103-138699125 CCACTTCTCTATTTCCTGCCTGG + Intergenic
1016356454 6:143224020-143224042 CCTCTTCTGTGTTACGTGCCTGG + Intronic
1017124789 6:151055391-151055413 CCATCTCGGTTTTACATGCAAGG + Intronic
1018633731 6:165842812-165842834 CCAAGTCCGTTTTAACTGCAAGG - Intronic
1022772793 7:33492564-33492586 CTACATCTGTGTTACCTGCCTGG - Intronic
1023514923 7:40992390-40992412 CCACACCTGTTTTATCAGCAAGG + Intergenic
1026583648 7:71638262-71638284 CCGCAACTGTTTTATCTGCAAGG + Intronic
1027758002 7:82240650-82240672 CCACTTATGTTTTACTTAAAAGG + Intronic
1028719541 7:94012881-94012903 CCACTTCTGTGGTATCTTCAGGG - Intergenic
1030822406 7:114111444-114111466 ACAATTCTGTGTTAGCTGCATGG - Intronic
1033928739 7:146496797-146496819 CCATTTTTGTTATACCTGAATGG - Intronic
1035691956 8:1565737-1565759 CCACTTCTCATTCTCCTGCAGGG - Exonic
1035950140 8:4010848-4010870 CTCCAGCTGTTTTACCTGCAAGG - Intronic
1036643602 8:10599033-10599055 CCGGTGCTGTTTTACCTGCAGGG - Intergenic
1038379278 8:27077220-27077242 CCACTTCTGTATTACCTGGCAGG + Intergenic
1039886417 8:41656599-41656621 CCACTCATGTTCTATCTGCAGGG + Intronic
1041503187 8:58561530-58561552 CCACTTCTTTCTGACCTGCAAGG - Intronic
1041991749 8:64001143-64001165 CCTGTTCTCTTTTACCTTCAGGG - Intergenic
1046336688 8:112798980-112799002 CAACTTGTATTTTACATGCAGGG - Intronic
1048493745 8:134918544-134918566 CCTCTTTTTTTCTACCTGCATGG - Intergenic
1052012658 9:23429246-23429268 ACACTTCTGTGTTACTTGTAGGG - Intergenic
1053108144 9:35431471-35431493 CAACTTCTGTTTTACAGACAGGG - Intergenic
1055821386 9:80268718-80268740 TCACATCTTTTTTTCCTGCAAGG + Intergenic
1057940953 9:99283719-99283741 CAACTTCTGTTTTAGATTCAAGG - Intergenic
1058647202 9:107141709-107141731 CCATTTCTATTTTTCCTTCATGG - Intergenic
1058669935 9:107352275-107352297 AAACTTCTGTTTTACATTCAGGG + Intergenic
1059787845 9:117605917-117605939 GCCCTTCTATTTTACATGCAGGG + Intergenic
1062112939 9:134792031-134792053 CCACTTCTGTCCCTCCTGCAGGG - Intronic
1188362300 X:29270865-29270887 AAACTTCTGTTTTACATTCAGGG + Intronic
1189909082 X:45791583-45791605 CCACTTCTTTCTTTCCTCCATGG - Intergenic
1195971303 X:110476844-110476866 CAACTTTTGTTTTAGCTTCATGG + Intergenic
1196836240 X:119816566-119816588 CCTCTTCTGTTCTACTTGCCTGG - Intergenic
1196933743 X:120708137-120708159 CAACTTCTATTTTACATTCAGGG - Intergenic
1197184272 X:123569527-123569549 GTACTTGTGTTTTACCTGAAAGG + Intergenic
1201378272 Y:13344990-13345012 CCACCTTTGTATTTCCTGCATGG - Intronic