ID: 997631718

View in Genome Browser
Species Human (GRCh38)
Location 5:135373796-135373818
Sequence AGGGTGGGCCCTCAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 372}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997631712_997631718 -5 Left 997631712 5:135373778-135373800 CCATACTCCTACCACCATAGGGT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG 0: 1
1: 0
2: 5
3: 49
4: 372
997631708_997631718 12 Left 997631708 5:135373761-135373783 CCAAAATTACTGCCTCTCCATAC 0: 1
1: 0
2: 1
3: 5
4: 160
Right 997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG 0: 1
1: 0
2: 5
3: 49
4: 372
997631709_997631718 0 Left 997631709 5:135373773-135373795 CCTCTCCATACTCCTACCACCAT 0: 1
1: 0
2: 3
3: 28
4: 334
Right 997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG 0: 1
1: 0
2: 5
3: 49
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997631718 Original CRISPR AGGGTGGGCCCTCAGCCCTG TGG Intronic
900163665 1:1236285-1236307 AGGGTGTGTGCTGAGCCCTGCGG - Intergenic
900171784 1:1272962-1272984 AAGGTCGGGCCTCAGCCCGGTGG - Intronic
900425240 1:2575327-2575349 AGGGTGGTCCCTCTGCCCCCAGG + Intergenic
900981899 1:6050443-6050465 AGGGTGAGGACTCAGCCCCGAGG + Intronic
900991547 1:6100476-6100498 AGGGTGGGCCACCTGCCCTCTGG - Exonic
901239016 1:7682161-7682183 AGGGTCCCCCCTCACCCCTGAGG - Intronic
901316350 1:8312383-8312405 AGGGGGGGCTCTCAGGCATGGGG + Intergenic
901809884 1:11761683-11761705 CGGGTGTGTCCTCAGCCATGAGG + Intergenic
902374151 1:16022453-16022475 TGTGTGTGCCCTCATCCCTGAGG - Intronic
902511733 1:16970389-16970411 AGGTGGAGCGCTCAGCCCTGCGG + Exonic
902578156 1:17391625-17391647 TGGGTGGGTCTTGAGCCCTGGGG - Intronic
902713235 1:18254939-18254961 ACACTGGGCCCTCAGCACTGTGG + Intronic
902961086 1:19963214-19963236 AGGGGTGGCACTCAGCACTGAGG - Intergenic
903295222 1:22339350-22339372 GTGGTGAGGCCTCAGCCCTGTGG - Intergenic
904284813 1:29447046-29447068 AGGCTGCACGCTCAGCCCTGGGG + Intergenic
904567656 1:31437282-31437304 AGCATGGGCCCTCAGGGCTGAGG - Intergenic
905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG + Intergenic
905394276 1:37657243-37657265 AGGGAGGGCCCCCAGCCCTCAGG + Intergenic
905407663 1:37746429-37746451 AGGGTGGGCCCTAATCCATTAGG - Intronic
905864781 1:41370822-41370844 AGGGAGCTGCCTCAGCCCTGGGG - Intronic
905891135 1:41519105-41519127 AGCTTGGGCCCCCAGCCTTGTGG - Intronic
906315309 1:44783288-44783310 ATGGTGGGCCTGCAGCGCTGGGG - Intergenic
906696326 1:47825737-47825759 AGGGTGGGCACTGAGCCGGGAGG + Intronic
912227739 1:107754683-107754705 ATGGTGGGCTCTGAGCCATGAGG - Intronic
913074688 1:115331920-115331942 ATGGTGGGCCCCCTCCCCTGTGG + Intronic
914958661 1:152187249-152187271 AGGGTGAGCCCTCAGCACTTTGG + Intergenic
915487569 1:156232488-156232510 AGGGTGGGGCCACTGCCCTCAGG - Intronic
916029610 1:160864364-160864386 AGGGGCAGCCCTCAACCCTGGGG + Intergenic
918790732 1:188824068-188824090 ATGGTGGTCCCTCAGCTCTGAGG - Intergenic
919795812 1:201320843-201320865 AGGGGGGACACTAAGCCCTGGGG - Intronic
919922385 1:202174320-202174342 AGGGTGGCCTTTGAGCCCTGTGG + Intergenic
919963226 1:202493276-202493298 GGGGAGGGCCAGCAGCCCTGGGG + Exonic
920022586 1:202967071-202967093 ACGGTGGGCCCAGAGCCCTGCGG + Intronic
920339712 1:205268161-205268183 AGTGTAGGCGGTCAGCCCTGAGG + Intronic
921159422 1:212462737-212462759 AGCCTGAGCCCTGAGCCCTGGGG - Intergenic
922701067 1:227761324-227761346 AGGGTGTGTATTCAGCCCTGGGG - Intronic
923396154 1:233567071-233567093 AGCCTGGGCTCTCAGCCCTGTGG - Intergenic
1062972010 10:1655152-1655174 AGGGTGTCCCCTGAGCCCTGAGG + Intronic
1063072397 10:2679869-2679891 AGGGTGGGCCATGAGCCCAGGGG + Intergenic
1063289140 10:4723553-4723575 AGGGAGTGCCCTGTGCCCTGTGG + Intergenic
1064996825 10:21303345-21303367 AGGGAGGGTGCTCAGCCCCGTGG + Intergenic
1065190650 10:23204791-23204813 ACGTTGGGCTCTCTGCCCTGTGG + Intronic
1065815672 10:29480479-29480501 AGGCTGGCCCGGCAGCCCTGCGG - Intronic
1066519995 10:36206605-36206627 AGGGTGGGACCTCGGCTATGAGG + Intergenic
1069882742 10:71603678-71603700 CTGGTGCTCCCTCAGCCCTGGGG - Intronic
1070159065 10:73854678-73854700 AGGGAAGCACCTCAGCCCTGAGG - Intronic
1070569137 10:77627834-77627856 AGGGTGGGCTTCCAGCACTGGGG + Intronic
1070742712 10:78913322-78913344 AGGGTGGGGGCTCACACCTGGGG - Intergenic
1070931046 10:80260724-80260746 ATGGGGGTCCCTGAGCCCTGAGG + Intergenic
1072617615 10:97060011-97060033 TGGGTGGTCCCACAGCCCTGGGG - Intronic
1073336703 10:102714974-102714996 GGGGCTGGCCCTGAGCCCTGAGG + Intronic
1073470084 10:103716823-103716845 AGGCTGCAACCTCAGCCCTGAGG + Intronic
1074249594 10:111731178-111731200 AGGGGTCTCCCTCAGCCCTGTGG - Intergenic
1074777706 10:116778455-116778477 AGGGAGGGACCACAGCCCTGAGG - Intergenic
1074777865 10:116779411-116779433 AGGGAGGGGCCACAGCCCTGAGG - Intergenic
1075214788 10:120522967-120522989 AGGGTGAGCCCTAAGCCCAGTGG + Intronic
1075583931 10:123643681-123643703 GTGGTGGGCTGTCAGCCCTGAGG - Intergenic
1075672007 10:124269233-124269255 AGAGTGGGCCCGCTCCCCTGGGG + Intergenic
1076055332 10:127367952-127367974 TGGGGTGGCCCCCAGCCCTGTGG + Intronic
1076454463 10:130580121-130580143 AGGCTGGTCCCTGAGGCCTGTGG + Intergenic
1076822167 10:132944822-132944844 AGGGTGGGCCCTAAACCCCATGG - Intergenic
1076829770 10:132988605-132988627 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829783 10:132988642-132988664 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829796 10:132988679-132988701 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829809 10:132988716-132988738 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829822 10:132988753-132988775 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829835 10:132988790-132988812 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829848 10:132988827-132988849 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829861 10:132988864-132988886 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829874 10:132988901-132988923 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829887 10:132988938-132988960 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829924 10:132989023-132989045 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076829937 10:132989060-132989082 AGGGAGGGGCCTGAGGCCTGGGG + Intergenic
1076883599 10:133251539-133251561 CGGGTGGTCCCTCGGCCCTCAGG - Intergenic
1076994290 11:290636-290658 AGGGAGGGAGCTCATCCCTGAGG + Intronic
1077158210 11:1100883-1100905 AGGGTAGGGCCTCAGGCCTGTGG - Intergenic
1077218272 11:1404163-1404185 AGGTTGGAGACTCAGCCCTGCGG + Intronic
1077289963 11:1784496-1784518 AGGGTGGGCCCTAATCCCATAGG - Intergenic
1077440375 11:2566078-2566100 AGGGAGGTGTCTCAGCCCTGTGG - Intronic
1079562478 11:21839587-21839609 CAGCTGGGCCCTCAGCCCTTTGG - Intergenic
1083274270 11:61587962-61587984 AGGGTGGGGCCTCAATCCTGGGG - Intergenic
1083544452 11:63538246-63538268 AGGGTGTGTCCTGGGCCCTGAGG + Intronic
1083814868 11:65126989-65127011 AGGGTGGGGTCTCAGGCCTTTGG - Exonic
1083818065 11:65148798-65148820 AGGCTGGGCCCACTGCACTGTGG - Intergenic
1084317391 11:68353537-68353559 AGTGTGGGCGCTGAGTCCTGGGG + Intronic
1084588855 11:70078806-70078828 AGGGTGCGGCCCCCGCCCTGGGG - Intronic
1084793254 11:71488440-71488462 ATGATGGGCTCTCAGTCCTGGGG - Intronic
1085085001 11:73661059-73661081 GGGATGGCTCCTCAGCCCTGCGG + Intronic
1085303858 11:75474112-75474134 AGGCTGTGCCCTCAGCCCCTTGG + Intronic
1085388546 11:76170761-76170783 AGGGGGGGCCCTGTGGCCTGTGG + Intergenic
1085399316 11:76226061-76226083 AGGGTGGGCACACACCTCTGTGG - Intergenic
1085529550 11:77183354-77183376 AGGGTGGGATCTCAGGCCGGGGG + Intronic
1086150187 11:83600636-83600658 AGACTGGGGCCTCTGCCCTGGGG + Intronic
1090235749 11:125145549-125145571 AGGGTGAGGCCTCAGTGCTGGGG - Intergenic
1090352424 11:126115810-126115832 AAGGAGGGCCCACTGCCCTGTGG + Intergenic
1090404155 11:126467228-126467250 GGGGTGGGTGCACAGCCCTGAGG - Intronic
1090456917 11:126857960-126857982 AGCTTGTGCCCTGAGCCCTGTGG - Intronic
1091793444 12:3284317-3284339 ACCGTGGGTCCTCACCCCTGTGG - Exonic
1094526840 12:31236872-31236894 AGAGCGTGCCCTCAGCCCTGGGG + Intergenic
1097284206 12:57865271-57865293 AGGCCGGGCCCCCAGCCCGGAGG - Intergenic
1097685879 12:62690480-62690502 AGGATGAGGTCTCAGCCCTGAGG - Intronic
1101840558 12:108324754-108324776 AGGGTGCACCCTCAGCCCTCAGG - Intronic
1101879489 12:108616727-108616749 TGGCTGGGCCCTGAGCCCAGAGG - Intergenic
1102985945 12:117278384-117278406 AGGGTTTGCCCTCTGTCCTGTGG - Intronic
1103705660 12:122870422-122870444 ATGGAGGGCCCCCAGACCTGCGG - Intronic
1103923289 12:124410568-124410590 AGGATGGGCCCACAGCCTTCCGG - Intronic
1103952213 12:124557497-124557519 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1104747542 12:131219679-131219701 AGGGTGGGCCCCATGCCCTGAGG - Intergenic
1104892853 12:132148705-132148727 GGGGTGAGGCCTCCGCCCTGGGG - Intronic
1104893441 12:132150979-132151001 AGGGGGGGCCCTCAGCCTCTTGG + Exonic
1104894801 12:132158884-132158906 AGGGTGGGCCATCAGTCCGGTGG + Intergenic
1104946006 12:132415169-132415191 AGGGTGGGCCCCGAGCTCTCAGG + Intergenic
1105456292 13:20544287-20544309 AGAGAGGGCCTTAAGCCCTGAGG + Intergenic
1105701531 13:22938825-22938847 CGGGTGGGCCGTCAGTGCTGAGG + Intergenic
1106036559 13:26050262-26050284 AGGGTGCGCCCCCACCCGTGAGG - Intronic
1107893000 13:44930566-44930588 AGGGTGAGGACTCAGCCCTCTGG - Intergenic
1108373914 13:49795881-49795903 AGGAAGGGCCCTCAGCCCAGGGG + Intergenic
1113543979 13:111131963-111131985 GGGGTGGACCGTGAGCCCTGTGG + Intronic
1113770151 13:112903089-112903111 AGTGTGGGCACTCACCACTGAGG + Intronic
1113820454 13:113209285-113209307 AGGGGGTGCCCGGAGCCCTGGGG + Intronic
1113881777 13:113630969-113630991 AGGGAGGGCCACCAGCACTGGGG - Intronic
1114430537 14:22656883-22656905 AGCCTGGGGCCCCAGCCCTGTGG - Intergenic
1115643013 14:35347423-35347445 AGGCTGGCCCCTCAGCCCACAGG + Intergenic
1118325367 14:64776989-64777011 AGGCTGGGCCTTCCTCCCTGGGG + Intronic
1119181862 14:72610791-72610813 GTGGTGGGCCCTGAGCCCTCAGG - Intergenic
1119383800 14:74244813-74244835 AGTGTGAGCCCTCAGCCTTGAGG + Intronic
1120437109 14:84495393-84495415 AGGGTGGGCCCCAAGGCCTTGGG - Intergenic
1121160099 14:91730201-91730223 AGGGTGGGCCCTCATCCAATAGG + Intronic
1121444924 14:93972780-93972802 AGGGTGGGCCTTTGGCCATGGGG + Intronic
1121527396 14:94628544-94628566 TGGATGGGCCCTCAGCCCCCAGG - Intergenic
1122365965 14:101195011-101195033 TGGGTGGGTGCTCAGGCCTGTGG + Intergenic
1122737989 14:103854901-103854923 AGGGAAGGCCCTCTGCCCTCAGG - Intergenic
1123011927 14:105353360-105353382 AGGGGGGGCCATCACCCCAGGGG - Intronic
1123011940 14:105353392-105353414 AGGGGGGGCCGTCACCCCAGGGG - Intronic
1123708200 15:22966016-22966038 AGGGTGGGCCCTCATCCAATAGG + Intronic
1124784877 15:32670367-32670389 AGGGCCAGCCCTCTGCCCTGAGG + Intronic
1125673927 15:41492762-41492784 AGGGGGGACCCTCACTCCTGTGG + Intergenic
1128451910 15:67810756-67810778 AGATGGGGCCCTCAGACCTGAGG + Intergenic
1128882203 15:71254246-71254268 AGGGTGGGCCTTCAGCGCTCTGG + Intronic
1129523825 15:76201752-76201774 TGGATGGCACCTCAGCCCTGTGG + Intronic
1129657108 15:77531624-77531646 AGGGTGGCTGCTCAGCCCAGAGG + Intergenic
1129673788 15:77621613-77621635 AGGGCCTTCCCTCAGCCCTGGGG - Intronic
1129945362 15:79534864-79534886 AGGGTGGGCCCCCATCCTGGGGG - Intergenic
1130093435 15:80839552-80839574 AGGGTGGGCCTTCAGCAACGGGG + Intronic
1130542930 15:84835017-84835039 AGGCTGAGGCCCCAGCCCTGGGG + Intronic
1130612457 15:85373773-85373795 AGGGTGGTCCCTTAATCCTGAGG + Intergenic
1131130991 15:89900140-89900162 ATGCTGGGACCTCAGCCATGGGG - Exonic
1132525771 16:413789-413811 AGGTATGCCCCTCAGCCCTGCGG + Intergenic
1132838353 16:1965938-1965960 AGGCTGGGCCCCCTGCTCTGGGG + Intergenic
1132838882 16:1968614-1968636 AGGGTGGCCCCGCAGCCCAGGGG - Exonic
1133209908 16:4257807-4257829 AGGGCGGGGCCTCGGCCCCGGGG - Exonic
1133270691 16:4609654-4609676 AGGGTGGGCCCTGGGTTCTGAGG + Exonic
1134231800 16:12435676-12435698 AGTCTGGGTCCTCAGCCTTGTGG + Intronic
1134234191 16:12452642-12452664 AGGGAGGGTCACCAGCCCTGGGG + Intronic
1135154614 16:20041691-20041713 ATGGTGGGACAGCAGCCCTGGGG - Intronic
1135233001 16:20727379-20727401 AGGGGAGGCCCTCACCCCGGAGG + Intronic
1135477466 16:22789555-22789577 AGGGTGCAGCCTCAGCACTGGGG - Intergenic
1136107494 16:28040668-28040690 AGGGAAGGCTCTCAGGCCTGGGG - Intronic
1136485807 16:30571185-30571207 AGGGGGTGCCCTCAGCCTGGAGG - Intronic
1136609452 16:31357247-31357269 ACGGTGGGGCCGCAGGCCTGGGG - Exonic
1137442781 16:48510709-48510731 TGGGTGGCCCTGCAGCCCTGGGG + Intergenic
1138351554 16:56348714-56348736 AGGGAGGGCAGTCAGGCCTGGGG + Intronic
1138546953 16:57725438-57725460 AGACTGTGCCCTCAGCCATGGGG + Intronic
1138631220 16:58295567-58295589 AGGGTGGGCGCACAGGCCTCTGG + Intronic
1139283341 16:65788529-65788551 AGGGTGGTCCCTCAGCACCCAGG + Intergenic
1139513089 16:67438264-67438286 AGGAGGCCCCCTCAGCCCTGTGG - Exonic
1139593452 16:67945518-67945540 AGGATCGGCACTCGGCCCTGCGG - Exonic
1140868386 16:79084143-79084165 AGGGTGGGGCCGCAGCTCTCAGG + Intronic
1141522917 16:84593372-84593394 AGGTGGGGCCCTCACCCCTCGGG - Intronic
1141621746 16:85240033-85240055 AGAGTGAGCCTGCAGCCCTGTGG + Intergenic
1141788474 16:86217259-86217281 AGGGTGAGGACTCTGCCCTGGGG + Intergenic
1141788989 16:86220232-86220254 AGGGAGGGCACACAGGCCTGGGG - Intergenic
1141989974 16:87603832-87603854 AGGCTGGGCCCGCGGCCCTGGGG + Intronic
1142115016 16:88351950-88351972 AGGGAGGCCCCTCCGCCCCGAGG + Intergenic
1142155985 16:88533109-88533131 GGGGTGGCACCTCAGGCCTGGGG - Intronic
1142412859 16:89924950-89924972 AGGGAGGGCAGGCAGCCCTGGGG + Intronic
1142412880 16:89925003-89925025 AGGGAGGGCAGGCAGCCCTGGGG + Intronic
1203081625 16_KI270728v1_random:1148409-1148431 AGGGGCGGCCCGGAGCCCTGCGG - Intergenic
1143020289 17:3914061-3914083 AGCCTGGGCCTGCAGCCCTGGGG + Intronic
1143376261 17:6469370-6469392 GGGGTGGGTCCCCAGCCCGGTGG - Intronic
1145963388 17:28900759-28900781 AGCCTGGGTCCTCAGCCCTGGGG - Intronic
1148698410 17:49574755-49574777 TGGGTGGGCACTCTGCTCTGTGG - Intergenic
1148758949 17:49989557-49989579 AGGGTGGGGCCTCAGTCAGGGGG - Intergenic
1149451329 17:56752141-56752163 CTGGTGGCCTCTCAGCCCTGAGG - Intergenic
1150294984 17:64002670-64002692 AGGGCTGGACCTCAACCCTGAGG + Exonic
1150448920 17:65249442-65249464 AGGTTGGGTCCCCAGCCGTGGGG - Intergenic
1150552260 17:66221588-66221610 AGGATGGTCCCTCAGCACTGAGG - Intronic
1151347367 17:73510293-73510315 AGATTGAGCCCTCAGGCCTGTGG - Intronic
1151404891 17:73879847-73879869 GGGAGGGGACCTCAGCCCTGAGG + Intergenic
1151815884 17:76471193-76471215 ATGGTGGGCACCCAGCCCTGGGG + Exonic
1152030880 17:77842280-77842302 AGGCTGGGCACTCAGTGCTGGGG - Intergenic
1152142876 17:78548662-78548684 AGGCTGTGCCCTTAGCCCTCAGG - Intronic
1152352981 17:79793587-79793609 AGGGCGGGCCGCCAGCTCTGTGG - Exonic
1152539227 17:80966590-80966612 AGGCAGTGCCCCCAGCCCTGTGG + Intergenic
1152658447 17:81530704-81530726 AGGGTGGGGCCTCTGCCATCTGG - Intronic
1152687514 17:81701857-81701879 AGGGGAAGCCCCCAGCCCTGTGG + Exonic
1152775919 17:82201916-82201938 AGGGCGGGCTCTGAGCCCAGTGG + Exonic
1154293589 18:13131209-13131231 TGGGTGGGCCATCTTCCCTGAGG - Intergenic
1155147853 18:23098686-23098708 AGGATGGACCCTCTGGCCTGCGG - Intergenic
1155620432 18:27772102-27772124 AGGGTGGGCCACCATCCCTTTGG - Intergenic
1157081062 18:44525713-44525735 ATGCTGGGCCCTTAGGCCTGGGG - Intergenic
1158490759 18:57907460-57907482 GGGGAGAGCCCTGAGCCCTGAGG + Intergenic
1158552013 18:58444338-58444360 AGGCCAGTCCCTCAGCCCTGTGG + Intergenic
1158894112 18:61897215-61897237 AGGATGGGACCCCAGCACTGGGG + Intergenic
1158930927 18:62324973-62324995 AGGCGGGGCCCACAGGCCTGGGG + Intergenic
1161027869 19:2044967-2044989 GGTGTGGGCCCTCTGCCCTCGGG - Intronic
1161137342 19:2627393-2627415 AGAGTGGGGCCCCAGCCCTGTGG + Intronic
1161746462 19:6063270-6063292 AGGGCTGGCGCTCAGGCCTGGGG - Intronic
1162022153 19:7872858-7872880 AAGGAGTGCCCTCAGCGCTGGGG - Exonic
1162161838 19:8723855-8723877 AGGGTGGACCATTGGCCCTGAGG + Intergenic
1162589180 19:11579257-11579279 TGGGTGGGGTTTCAGCCCTGGGG + Intronic
1163454747 19:17399908-17399930 AGGGTGGGCCTTCACTTCTGTGG - Intergenic
1163601221 19:18250276-18250298 GGGCTGGGGGCTCAGCCCTGGGG - Intronic
1163721556 19:18900349-18900371 AGGGTTGGCCTGGAGCCCTGGGG + Intronic
1164620751 19:29694795-29694817 AGGCTGTGTCCCCAGCCCTGTGG + Intergenic
1164780025 19:30884615-30884637 ATGTGCGGCCCTCAGCCCTGCGG + Intergenic
1165820018 19:38668959-38668981 AAGGTGACTCCTCAGCCCTGGGG - Intronic
1167454237 19:49590243-49590265 AGGGTGGGGCCTGTGCCCAGAGG + Intronic
1167798540 19:51726323-51726345 AGGGTGAGTCCTCCGCCCAGTGG + Intergenic
925302143 2:2824865-2824887 AGGGTGGGCCCTGATCCCATAGG - Intergenic
925351810 2:3206299-3206321 CAGGTAGGCCCTTAGCCCTGAGG + Intronic
925915345 2:8600575-8600597 AGGGGGTGCCCTCGGCTCTGGGG - Intergenic
926121404 2:10243102-10243124 AGGCTGGGTCCTGAGCTCTGAGG + Intergenic
926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG + Intronic
927198345 2:20563416-20563438 AGGCTGGGCCCTCATTGCTGGGG - Intronic
927843131 2:26457756-26457778 AGGGTGGCGCCTCAGCCAGGTGG + Exonic
928240535 2:29581715-29581737 AGTGAGGGACCTCAGCCCTCTGG + Intronic
928251950 2:29688883-29688905 AGGGTGGCCACTGAACCCTGTGG + Intronic
933992528 2:87643798-87643820 GGGGTGACCCCTCAGCCATGGGG - Intergenic
934678584 2:96266515-96266537 AGGCTGAGCCCTCAGCGCTGAGG - Intronic
934937542 2:98476445-98476467 AGGGTGGGCCCCTCGCTCTGGGG + Intronic
936007824 2:108906233-108906255 GGGCTGGGCCCGGAGCCCTGAGG - Intronic
936231153 2:110700522-110700544 AGGGTGGGGTCTCAGGCCTTTGG + Intergenic
936301325 2:111307043-111307065 GGGGTGACCCCTCAGCCATGGGG + Intergenic
936383878 2:112011816-112011838 AAGGTGGGCACTGAGCTCTGGGG + Intronic
937286970 2:120760028-120760050 AGGGAGGGGCTTTAGCCCTGGGG + Intronic
938307690 2:130266216-130266238 CTGGTGGGTCCTCAGCGCTGAGG - Intergenic
938447646 2:131390625-131390647 CTGGTGGGTCCTCAGCGCTGAGG + Intergenic
938656765 2:133442607-133442629 GGAGCTGGCCCTCAGCCCTGGGG - Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946038809 2:216766232-216766254 AGGCTGGGGGCCCAGCCCTGGGG + Intergenic
946307865 2:218866175-218866197 AGAGGGAGCCCTGAGCCCTGGGG - Intronic
947524889 2:230871854-230871876 AGTGTGGGGCCTGGGCCCTGGGG - Intronic
947739125 2:232476908-232476930 GGGGGTGCCCCTCAGCCCTGGGG - Intergenic
948093317 2:235314081-235314103 GGGGTAGACTCTCAGCCCTGGGG + Intergenic
948454783 2:238099898-238099920 AGGCGGGGCGCTCAGCTCTGTGG + Intergenic
948816540 2:240513183-240513205 AGGGTGGGCCTTCCTACCTGTGG - Intronic
948866151 2:240775804-240775826 AGGGTGGGATCAGAGCCCTGGGG + Intronic
948942804 2:241204490-241204512 CGGGTGGGCCCACAGCTCTGTGG + Intronic
949034351 2:241809838-241809860 AGGGTGTGCCCGCAGAGCTGGGG - Intronic
1168932172 20:1632700-1632722 AGGGCTGTCCCTCAGTCCTGAGG - Intronic
1169276633 20:4237546-4237568 AGTGTGTGCCCTTAGCCCTGGGG + Intronic
1170855714 20:20052228-20052250 AGGGGCATCCCTCAGCCCTGAGG - Intronic
1172015305 20:31869705-31869727 AGAGTGCTCCCTGAGCCCTGAGG - Intronic
1172167390 20:32907537-32907559 AAGGAGGGCCCCCAGCACTGTGG - Intronic
1172669437 20:36624777-36624799 TGGGTGGGCCCTCTGTCCTCAGG - Intronic
1173167370 20:40694984-40695006 AGGTGAGGGCCTCAGCCCTGGGG - Intergenic
1173167805 20:40698325-40698347 AGGATGAGCACTCAGCCCTGAGG - Intergenic
1173551518 20:43936158-43936180 AAGGTGGGCACTCACCTCTGTGG - Intronic
1173557247 20:43974608-43974630 TGGGTGGCCCCTCAGCCATCAGG + Intronic
1175294248 20:57897555-57897577 AGCTTTGGCCCTCAGCCCAGGGG + Intergenic
1175763054 20:61574050-61574072 AGCGAGGACCCACAGCCCTGGGG + Intronic
1175900591 20:62358474-62358496 TGGTTGGGCACTCAGCCATGTGG - Intronic
1175969251 20:62675600-62675622 AGGCTGGGTCATCAGGCCTGGGG - Intronic
1176087715 20:63305616-63305638 AGGGTGGGACCCCAGCCCAGAGG - Intronic
1176148866 20:63578801-63578823 AGGCCTGGCCCTAAGCCCTGGGG - Intergenic
1176149195 20:63580713-63580735 AGGCCTGGCCCTAAGCCCTGGGG + Intergenic
1176385025 21:6134889-6134911 AGGGTGACCCCACAGCACTGTGG - Intergenic
1176674775 21:9767985-9768007 CGGAGGAGCCCTCAGCCCTGCGG - Intergenic
1178564214 21:33668372-33668394 AGGATGGGCTCTCTGCCATGAGG + Intronic
1179567152 21:42256317-42256339 AGGGTGGGCCCTCTCTGCTGGGG + Intronic
1179675209 21:42975729-42975751 ACGGCGGGGCCGCAGCCCTGGGG + Intronic
1179738448 21:43403363-43403385 AGGGTGACCCCACAGCACTGTGG + Intergenic
1179802487 21:43817443-43817465 AGGGTGGGACCACAGCACTGAGG - Intergenic
1179940592 21:44637038-44637060 AGCGTGGGCCCTCAGCCTGGGGG - Intronic
1181035781 22:20169187-20169209 ATGGTGGGTGCTGAGCCCTGGGG - Intergenic
1181365370 22:22372388-22372410 AGGGCGGGCCTCCAGGCCTGTGG + Intergenic
1181687988 22:24542551-24542573 TGGAGGGGTCCTCAGCCCTGGGG + Exonic
1181724873 22:24804793-24804815 AGGGAGGGCCCAGACCCCTGGGG - Intergenic
1183058155 22:35319602-35319624 AGGGTGGGCCCCCAGGTCAGTGG + Intronic
1183208059 22:36432974-36432996 AGGGCAGCCCCACAGCCCTGCGG - Intergenic
1183864860 22:40695980-40696002 AGGCTGGGGGCTGAGCCCTGAGG - Intergenic
1184234026 22:43173671-43173693 AGCCAGGGCCCTGAGCCCTGGGG + Intronic
1184272714 22:43393711-43393733 AGGGTAGGGCCCCATCCCTGAGG - Intergenic
1184606290 22:45576553-45576575 AGGGTGGCCCCCCTGACCTGTGG + Intronic
1185010287 22:48309097-48309119 AGGATGGCTCCTCAGCCCTAGGG - Intergenic
1185073939 22:48673007-48673029 GGGGTGTGCCATCAGCCTTGGGG - Intronic
1185414973 22:50704896-50704918 ATGCTGAGCCCTGAGCCCTGTGG + Intergenic
950111188 3:10419769-10419791 AGGGTGGCCGCTGAGCTCTGTGG - Intronic
950387863 3:12674053-12674075 AAGGTGGGTCTTCAGCCCTGAGG - Intergenic
950647063 3:14383534-14383556 GGGGTGGGCTCTCAGGCCCGGGG - Intergenic
951114510 3:18844261-18844283 TGGGTGTCCCCCCAGCCCTGTGG - Intergenic
952952979 3:38539143-38539165 GGGCTGGGCCCGCAGACCTGTGG + Intronic
953223155 3:40991955-40991977 AGAGTTGGCCCTCTGCCCTCAGG + Intergenic
954362319 3:50128565-50128587 TGGGTGTGTCCTCAGCTCTGGGG + Intergenic
954613397 3:51957830-51957852 AGGTAGGGCCCCCTGCCCTGGGG + Exonic
954634096 3:52062297-52062319 AGGGTGGGGCTTCACCTCTGTGG + Intergenic
955556231 3:60140328-60140350 GGGGTATGACCTCAGCCCTGGGG + Intronic
957701888 3:83725996-83726018 AGGCTGGGCCCTCAGTCCTTGGG + Intergenic
960576103 3:119231251-119231273 AGGGTGGGCCCTCAGCTAGGTGG - Intronic
960586259 3:119323368-119323390 GGGGTGTGGCCGCAGCCCTGGGG - Intronic
960947260 3:122975176-122975198 AGGGTGGGCCCTGGGTCCAGGGG + Intronic
961006634 3:123410049-123410071 AGTGTGGCCCCATAGCCCTGAGG + Intronic
961333365 3:126155846-126155868 AGAGTGGGTCCTGAGCCCCGTGG + Intronic
963059599 3:141214516-141214538 AGGGAGGGACTTCAGCCATGGGG - Intergenic
963090126 3:141476261-141476283 AGGCTGAGACCACAGCCCTGTGG - Intergenic
965655160 3:170975819-170975841 AGGGTCTGACCTCAGCCTTGTGG - Intergenic
967976693 3:195039391-195039413 GGGTGGGGCCCGCAGCCCTGAGG - Intergenic
968503122 4:960327-960349 ATGGTGAGCCCTCTGCCCTGTGG - Exonic
968511512 4:997753-997775 AGGGTGGGCCCTCGGGCCTGTGG + Intronic
968522385 4:1039877-1039899 AGGGTGGGCACCCGGCCCAGTGG + Intergenic
968983106 4:3861300-3861322 AGGGAGGGACCTGAGCCCTTCGG - Intergenic
969483488 4:7459072-7459094 AGAGTGTGCCCCCAGCCCAGGGG - Intronic
969618102 4:8265420-8265442 AAGGTGGGGCTTCCGCCCTGAGG - Intergenic
973279023 4:48341072-48341094 CGAGTGGGCGCTCAGCCCGGCGG - Intergenic
975083203 4:70305338-70305360 AGGGGAGGCCCTCTGACCTGAGG + Intergenic
975710843 4:77158185-77158207 AGGGAGGGCCTTCTGCCCAGGGG - Intronic
975828203 4:78341647-78341669 TTGGTGCTCCCTCAGCCCTGGGG + Intronic
980514132 4:133831830-133831852 AGGTTGGGCTCTCTGACCTGAGG + Intergenic
980595428 4:134948338-134948360 AGGGTGGGCCAGCAGTGCTGGGG + Intergenic
985566500 5:620975-620997 AAGCTGGGGCCTCAGCCCAGGGG + Intronic
986319380 5:6615626-6615648 GGGTTGTGCCCTCAGCCCTGCGG - Intronic
988968578 5:36443830-36443852 TGGGAGGGCAATCAGCCCTGGGG + Intergenic
997593535 5:135091174-135091196 CGGGTGGGCCCTCAACCTTCAGG - Intronic
997631718 5:135373796-135373818 AGGGTGGGCCCTCAGCCCTGTGG + Intronic
997964553 5:138347026-138347048 AGGCTCGGCCCCCAGCCTTGGGG - Exonic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
999241964 5:150133017-150133039 GGGGTGGGGCTTCAGGCCTGGGG + Intronic
999311938 5:150557276-150557298 AGGCTGGGCCTTCGACCCTGGGG + Exonic
1001600628 5:172925987-172926009 ATGGGGGGCCCACAGCTCTGGGG + Intronic
1001744868 5:174084684-174084706 AGGGTGGGGCGTCAGCCCAGGGG - Intronic
1002313378 5:178328130-178328152 AGGGCGGCCCCTCTGCCCTTTGG + Intronic
1003399314 6:5778848-5778870 AGGCTCGACCCTCAGCACTGGGG - Intergenic
1003622641 6:7714810-7714832 AGGGAAGCCCCTCATCCCTGAGG + Intergenic
1006385934 6:33730954-33730976 AGGGAGGGTCGTCAGCGCTGAGG + Intronic
1006419581 6:33924815-33924837 AGGGAGGGCCCTCAGCCCTCTGG - Intergenic
1008383910 6:50865418-50865440 AGGGTGGGCCCTAAACTCAGTGG + Intergenic
1013419082 6:109949866-109949888 CGGGTGGCCCCTCAGCCCTGCGG - Intergenic
1013473882 6:110489436-110489458 AGGGTTGGCCCCCAGCGCTATGG + Intergenic
1017728875 6:157296726-157296748 ATGGTGGGCCCACGGCACTGGGG - Intronic
1017728885 6:157296774-157296796 ATGGTGGGCCCACGGCACTGGGG - Intronic
1018688000 6:166318488-166318510 AGGGCCGGCCCTCAGCCCTGCGG - Intergenic
1018862718 6:167722774-167722796 AAGGCGGCCCCTCTGCCCTGGGG - Intergenic
1018948857 6:168365393-168365415 AGTGTGGGGCCTCTGCTCTGAGG + Intergenic
1019357016 7:585755-585777 AGGGTGGTCACTCAGCCCTGCGG - Intronic
1020104025 7:5412867-5412889 ATGGTGGACCCTCAGCCTGGGGG - Intronic
1020382027 7:7557362-7557384 AGGGTGGTCCCTCAGGGCAGGGG - Intergenic
1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG + Intergenic
1023081935 7:36534174-36534196 AGGGTGGGCCTTCATCCCCAAGG - Intronic
1023725210 7:43136423-43136445 GGAGTGTGCTCTCAGCCCTGGGG - Intronic
1023856799 7:44189038-44189060 AGGGCGGGCCGTGACCCCTGCGG - Intronic
1025163080 7:56683017-56683039 GGGGTGGGCCCTCATGCCTTGGG + Intergenic
1026678420 7:72447407-72447429 TGCGTGGGTCCACAGCCCTGTGG - Intergenic
1026904787 7:74056754-74056776 AGGTTGGACCCTGAGCCCCGCGG - Intronic
1029271843 7:99381756-99381778 AGGCTGGTCACTGAGCCCTGTGG + Intronic
1032434496 7:131889038-131889060 AGAGTGTTCCCCCAGCCCTGTGG + Intergenic
1032783585 7:135183686-135183708 GGTGTGGACCCTCAGCTCTGGGG - Intergenic
1032992981 7:137414218-137414240 AGGGAAGGCACTCAGCCCAGGGG - Intronic
1033511424 7:142063665-142063687 AGGATGTGCCCTCAGCTGTGGGG - Intronic
1033559350 7:142516443-142516465 AGGCTGTGCCCTGAGCCCAGTGG + Intergenic
1034472929 7:151265220-151265242 AGGGTGGGCCCTCATCCAATAGG + Intronic
1034550678 7:151818708-151818730 AGGCTGGGCCTTGAGCCCAGGGG - Intronic
1034566226 7:151917735-151917757 ATAATGGGCCTTCAGCCCTGGGG - Intergenic
1034946708 7:155267051-155267073 AGGGTGGGCCCCCCGCAGTGTGG + Intergenic
1035285976 7:157807480-157807502 AGGATGGAGCCTCAGACCTGGGG + Intronic
1035290450 7:157834698-157834720 AGGCTGGGCCCGCAGCCCCGTGG - Intronic
1037758484 8:21726685-21726707 AGGGTGGGCCCTAAATCCAGTGG - Intronic
1037805145 8:22054777-22054799 AGGGTGGGTCCTCAGTGCTGGGG - Intronic
1038644055 8:29348928-29348950 AGGGTGGGTCCGCGGCCCTCGGG - Intronic
1040870761 8:52098333-52098355 AGGGTGGGCCCTAATCCCATAGG + Intergenic
1045843668 8:106607992-106608014 AGGGTGGGCACTGGGCACTGTGG + Intronic
1047761094 8:127955129-127955151 AGGGTGGGCCCTAAGCCAACTGG + Intergenic
1049082094 8:140451423-140451445 AGGGTAGGCTCTCAGCACTCAGG - Intronic
1049157939 8:141078335-141078357 AGGGTGGGCCCCAAACCCAGTGG - Intergenic
1049164191 8:141116497-141116519 ACGGTGACCCCTGAGCCCTGAGG - Intergenic
1049165748 8:141124771-141124793 AGGCTGTGCCCTCACCCGTGTGG + Intronic
1049190041 8:141282230-141282252 AGGGGGGGCCCTCAGCAAAGAGG + Intronic
1049242320 8:141544245-141544267 AGGCTGTGCCCTCTGACCTGGGG + Intergenic
1049242862 8:141547472-141547494 AGGATTGGCCCTCTGCCCTGGGG + Intergenic
1049338343 8:142098487-142098509 AGGGGTGGCCAGCAGCCCTGGGG + Intergenic
1049540863 8:143208175-143208197 GGCGTGGGCCCCCAGCCTTGGGG - Intergenic
1049654421 8:143791502-143791524 CGGGTGGGCTCCCAGCCCTGAGG + Intronic
1049804074 8:144531015-144531037 AGGCTGGGCCCTGACCCCAGAGG + Intronic
1050123492 9:2332340-2332362 TTTGTGGGCCCTCACCCCTGGGG + Intergenic
1053036045 9:34827405-34827427 GGGGTGGGCCCCCAACCCTTAGG + Intergenic
1053451518 9:38197870-38197892 TGGGTCGGCCCTCTGCCCTGTGG - Intergenic
1053572943 9:39328806-39328828 AGTGTGGCCCAGCAGCCCTGGGG - Intergenic
1053624293 9:39853008-39853030 AGCGTGGCCCAGCAGCCCTGGGG - Intergenic
1053880575 9:42590219-42590241 AGCGTGGCCCAGCAGCCCTGGGG + Intergenic
1053892095 9:42704111-42704133 AGTGTGGCCCAGCAGCCCTGGGG - Intergenic
1054094506 9:60887515-60887537 AGTGTGGCCCAGCAGCCCTGGGG - Intergenic
1054115977 9:61163427-61163449 AGTGTGGCCCAGCAGCCCTGGGG - Intergenic
1054124201 9:61290205-61290227 AGTGTGGCCCAGCAGCCCTGGGG + Intergenic
1054219603 9:62397689-62397711 AGCGTGGCCCAGCAGCCCTGGGG + Intergenic
1054231111 9:62511484-62511506 AGCGTGGCCCAGCAGCCCTGGGG - Intergenic
1054591780 9:67019117-67019139 AGTGTGGCCCAGCAGCCCTGGGG + Intergenic
1056078244 9:83062905-83062927 AGGGAGGGCCCTGCGCCCCGCGG - Exonic
1056747625 9:89318325-89318347 ACGGTGGGTCCCCAGCCCAGAGG + Intergenic
1057442122 9:95090528-95090550 AGGGGGGGCCCTCTGGGCTGGGG - Intergenic
1057882794 9:98806106-98806128 AGGCGGGGCCCTGAGCACTGTGG + Intergenic
1059073068 9:111159940-111159962 AGGGTGTGGCCTCAGCTCAGAGG - Intergenic
1059368036 9:113801796-113801818 ATGGTGGTACCTCATCCCTGGGG + Intergenic
1059435932 9:114276216-114276238 AGGCTGGGCCATGAGCCCTCAGG + Intronic
1060062769 9:120475852-120475874 AAGGTGGGACCCCTGCCCTGAGG + Intronic
1060189929 9:121585966-121585988 AGGGTGGGCTCCCAGCCCAGAGG - Intronic
1060757525 9:126224043-126224065 AGGGTGGGCAGGCAGGCCTGGGG - Intergenic
1061347866 9:130042113-130042135 GGGGACGGCCCTCAGCCCTGAGG + Intronic
1061790611 9:133057108-133057130 AGCCGAGGCCCTCAGCCCTGCGG + Intronic
1061990277 9:134154940-134154962 TGCGTGCACCCTCAGCCCTGTGG + Intronic
1062010652 9:134264959-134264981 AGAGTGGGGCGTCAGCTCTGTGG + Intergenic
1062060473 9:134492809-134492831 AGGGCGGGCACTCAGTTCTGTGG + Intergenic
1062108624 9:134769667-134769689 TGGCTGGGCCCAGAGCCCTGCGG + Intronic
1062158707 9:135068089-135068111 ACGGAGGGCTCTCAGCCCTGTGG + Intergenic
1062502316 9:136856829-136856851 AGGATGGGCGCTCAGACCGGGGG + Intronic
1186738453 X:12491810-12491832 AGGCTGGGCACTCACCCTTGAGG - Intronic
1195068532 X:101258573-101258595 AGGGTGGCCTCTGAGCCCAGGGG + Intronic
1198310356 X:135422984-135423006 AGGGTGTCCCCTGAACCCTGAGG + Intergenic
1199627948 X:149757967-149757989 GGGGTGGGCCCCCTGTCCTGGGG + Intergenic
1199628713 X:149761855-149761877 GGGGTGGGCCCCCTGTCCTGGGG + Intergenic
1199643045 X:149881799-149881821 AGGGTGGGCCCCCTGTCCTGGGG - Intronic
1199903953 X:152206197-152206219 AGGGTGGGCCTTCAGCCTCTAGG + Intronic
1199947442 X:152680289-152680311 TGGGTGGGCCCCCTGTCCTGGGG - Intergenic
1199962238 X:152788165-152788187 TGGGTGGGCCCCCTGTCCTGGGG + Intergenic
1200100548 X:153687679-153687701 AGGGGCGGCCCGGAGCCCTGCGG + Intronic
1200124783 X:153808123-153808145 AGGGTCCTCCCTCGGCCCTGGGG + Intronic
1202298877 Y:23389153-23389175 GGGGAGGGCCAGCAGCCCTGGGG + Intergenic
1202571932 Y:26281445-26281467 GGGGAGGGCCAGCAGCCCTGGGG - Intergenic