ID: 997632225

View in Genome Browser
Species Human (GRCh38)
Location 5:135377534-135377556
Sequence TCGTGGGCTGCACTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997632218_997632225 23 Left 997632218 5:135377488-135377510 CCCAGATGGACTCAAAGCGAAAG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG No data
997632219_997632225 22 Left 997632219 5:135377489-135377511 CCAGATGGACTCAAAGCGAAAGA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997632225 Original CRISPR TCGTGGGCTGCACTGTGTTG GGG Intronic
No off target data available for this crispr