ID: 997638587

View in Genome Browser
Species Human (GRCh38)
Location 5:135433991-135434013
Sequence AGGACTGTGTAGCGCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997638587_997638590 -7 Left 997638587 5:135433991-135434013 CCTGGGGAGCGCTACACAGTCCT No data
Right 997638590 5:135434007-135434029 CAGTCCTTCTGCTGGGAAGTCGG No data
997638587_997638592 0 Left 997638587 5:135433991-135434013 CCTGGGGAGCGCTACACAGTCCT No data
Right 997638592 5:135434014-135434036 TCTGCTGGGAAGTCGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997638587 Original CRISPR AGGACTGTGTAGCGCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr