ID: 997638884

View in Genome Browser
Species Human (GRCh38)
Location 5:135435567-135435589
Sequence CAGGGCACTCACACCGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997638875_997638884 27 Left 997638875 5:135435517-135435539 CCCTCTCTGGCTTGGCAACTGTG No data
Right 997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG No data
997638876_997638884 26 Left 997638876 5:135435518-135435540 CCTCTCTGGCTTGGCAACTGTGG No data
Right 997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG No data
997638874_997638884 28 Left 997638874 5:135435516-135435538 CCCCTCTCTGGCTTGGCAACTGT No data
Right 997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997638884 Original CRISPR CAGGGCACTCACACCGTTGC AGG Intergenic
No off target data available for this crispr