ID: 997639207

View in Genome Browser
Species Human (GRCh38)
Location 5:135437586-135437608
Sequence CTGTTTCAGGGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997639207_997639217 30 Left 997639207 5:135437586-135437608 CCCTCTTCCCTCCCCTGAAACAG No data
Right 997639217 5:135437639-135437661 TGCATTTGCGGCTCCTCTTGTGG No data
997639207_997639215 18 Left 997639207 5:135437586-135437608 CCCTCTTCCCTCCCCTGAAACAG No data
Right 997639215 5:135437627-135437649 GCACACTCCTTTTGCATTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997639207 Original CRISPR CTGTTTCAGGGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr