ID: 997639938

View in Genome Browser
Species Human (GRCh38)
Location 5:135442546-135442568
Sequence CTGTAAGGATGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997639938_997639949 2 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639949 5:135442571-135442593 GCTGAAGGTCACATAGGTTGGGG No data
997639938_997639950 14 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639950 5:135442583-135442605 ATAGGTTGGGGTGACAATGATGG No data
997639938_997639946 -4 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639946 5:135442565-135442587 ACAGATGCTGAAGGTCACATAGG No data
997639938_997639948 1 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639948 5:135442570-135442592 TGCTGAAGGTCACATAGGTTGGG No data
997639938_997639952 18 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639952 5:135442587-135442609 GTTGGGGTGACAATGATGGTGGG No data
997639938_997639951 17 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639951 5:135442586-135442608 GGTTGGGGTGACAATGATGGTGG No data
997639938_997639953 19 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639953 5:135442588-135442610 TTGGGGTGACAATGATGGTGGGG No data
997639938_997639947 0 Left 997639938 5:135442546-135442568 CCCTCCTCCCTCCATCCTTACAG No data
Right 997639947 5:135442569-135442591 ATGCTGAAGGTCACATAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997639938 Original CRISPR CTGTAAGGATGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr