ID: 997640190

View in Genome Browser
Species Human (GRCh38)
Location 5:135443844-135443866
Sequence CAGCACTCCTGGGCCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997640190_997640195 -8 Left 997640190 5:135443844-135443866 CCAGTAATGGCCCAGGAGTGCTG No data
Right 997640195 5:135443859-135443881 GAGTGCTGATATCCTTACTGGGG No data
997640190_997640194 -9 Left 997640190 5:135443844-135443866 CCAGTAATGGCCCAGGAGTGCTG No data
Right 997640194 5:135443858-135443880 GGAGTGCTGATATCCTTACTGGG No data
997640190_997640193 -10 Left 997640190 5:135443844-135443866 CCAGTAATGGCCCAGGAGTGCTG No data
Right 997640193 5:135443857-135443879 AGGAGTGCTGATATCCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997640190 Original CRISPR CAGCACTCCTGGGCCATTAC TGG (reversed) Intergenic
No off target data available for this crispr