ID: 997640392

View in Genome Browser
Species Human (GRCh38)
Location 5:135445110-135445132
Sequence CCTGCCAAGGAGACCCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997640392_997640400 4 Left 997640392 5:135445110-135445132 CCCTCCAGGGTCTCCTTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 236
Right 997640400 5:135445137-135445159 GTCCCCTATGAGCCTCTGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 117
997640392_997640401 5 Left 997640392 5:135445110-135445132 CCCTCCAGGGTCTCCTTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 236
Right 997640401 5:135445138-135445160 TCCCCTATGAGCCTCTGCAGGGG 0: 1
1: 0
2: 1
3: 13
4: 169
997640392_997640399 3 Left 997640392 5:135445110-135445132 CCCTCCAGGGTCTCCTTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 236
Right 997640399 5:135445136-135445158 TGTCCCCTATGAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 185
997640392_997640405 10 Left 997640392 5:135445110-135445132 CCCTCCAGGGTCTCCTTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 236
Right 997640405 5:135445143-135445165 TATGAGCCTCTGCAGGGGACAGG 0: 1
1: 0
2: 0
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997640392 Original CRISPR CCTGCCAAGGAGACCCTGGA GGG (reversed) Exonic
901196935 1:7445516-7445538 CCACCCAAGGTGACCCTGGACGG + Intronic
901648250 1:10728097-10728119 GGTGCCAAGGGGACACTGGAAGG - Intronic
902466837 1:16623869-16623891 CTGGCCAAGGAGACCCTGACTGG - Intergenic
902507765 1:16948905-16948927 CTGGCCAAGGAGACCCTGACTGG + Exonic
902852442 1:19170815-19170837 CCTTCCAAGGAGAAACTGCAAGG - Exonic
905863323 1:41364254-41364276 CCGGCTTTGGAGACCCTGGAGGG - Intronic
905888098 1:41502515-41502537 ACTGCTCAGGAGACCCTGGGAGG - Intergenic
906206330 1:43988966-43988988 CCTGCCAAATCAACCCTGGAAGG + Intronic
906805845 1:48777896-48777918 CTTGCCAAAGAGAGCCTGGAGGG + Intronic
907554801 1:55334538-55334560 CCTGCCCAGGAGCCACTGGGAGG - Intergenic
912386554 1:109273745-109273767 CCTCCCCAGGTGACTCTGGATGG + Intronic
913371700 1:118106830-118106852 CCTACCTAGGAGAACCTGGAGGG - Intronic
913671178 1:121098124-121098146 ACTGACAATGAGCCCCTGGAGGG + Intergenic
914022948 1:143885545-143885567 ACTGACAATGAGCCCCTGGAGGG + Intergenic
914661436 1:149793489-149793511 ACTGACAATGAGGCCCTGGAGGG + Intronic
914993369 1:152517424-152517446 CTTGCCAGGGAGGCTCTGGAGGG + Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
921283088 1:213586122-213586144 CATGCCAAGGTCACCATGGATGG - Intergenic
922461521 1:225817382-225817404 CCTGCCAAGCGGACGCAGGATGG - Intronic
922506212 1:226127314-226127336 GCGGCCAAGAAGACGCTGGAGGG + Intergenic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
924624461 1:245687697-245687719 CCCTCCAAGGCTACCCTGGAGGG + Exonic
1063859627 10:10293565-10293587 CCTGCCCATGTGTCCCTGGACGG + Intergenic
1064030921 10:11882183-11882205 CCTGCCCAGGAGAGACTGGGTGG + Intergenic
1069857864 10:71451616-71451638 CCCAACAAGGAGACCCAGGAAGG - Intronic
1070780773 10:79136270-79136292 TGCCCCAAGGAGACCCTGGAGGG - Intronic
1072690924 10:97571975-97571997 CCTGACAGGGAAACCCTGGGAGG + Intergenic
1075519711 10:123136264-123136286 GCGGCCAAGGGGGCCCTGGAGGG + Exonic
1075874147 10:125792731-125792753 CCTCCCCAGGAGTCCCTGTAGGG - Intronic
1075973145 10:126672339-126672361 CCTGTCCAGGAGACCCCGCAAGG + Intergenic
1076364774 10:129914727-129914749 CCTGCATGGGAGACCCTGGGAGG + Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1083262795 11:61532279-61532301 CTTTCCAAAGAGGCCCTGGAGGG - Intronic
1084561519 11:69908126-69908148 CCTGACAAGGAGCTCCTGGGAGG + Intergenic
1085029251 11:73259651-73259673 CCTGGCATCGAGACCCTGAAAGG + Intergenic
1085469895 11:76750983-76751005 CCTGCCAATGAGGGCCTAGATGG - Intergenic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1087288347 11:96291780-96291802 CCTTCCAAGGAGACCATGGTTGG - Intronic
1087635846 11:100699943-100699965 CAAGCCAAGAATACCCTGGATGG - Intronic
1087862761 11:103182657-103182679 CATGCAAAGAAGACCGTGGAGGG + Intronic
1088837599 11:113591071-113591093 CCTGCCCAGGAGAACCTAGAAGG + Intergenic
1090068710 11:123525706-123525728 GAAGCCAAGGAGACCCTGGGAGG - Exonic
1090315752 11:125786531-125786553 TCTGCCAAGGAGAACCTTGAAGG + Intergenic
1091085690 11:132719563-132719585 GCTGCCAAGGAGAACCAGAAGGG + Intronic
1091769215 12:3140512-3140534 CCTGCAGAGGAGTCCCTGCAGGG + Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1096111559 12:49031928-49031950 GCAGCCCAGGAGGCCCTGGAGGG + Exonic
1096407750 12:51356034-51356056 CCTCCCCAGGAGACCATGCATGG - Intronic
1096565277 12:52473111-52473133 CCTGCTAGGGAGACCTAGGAGGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1096817376 12:54210128-54210150 ACTCCCAGGGAGACTCTGGAGGG + Intergenic
1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG + Intronic
1098917912 12:76276224-76276246 CCTGCTAGGGAGACCCTGTGAGG + Intergenic
1099065532 12:77973634-77973656 CCTGGAAAAGATACCCTGGAAGG - Intronic
1099864340 12:88260312-88260334 CCTTCCCAGGAGATCATGGAGGG - Intergenic
1100079240 12:90827534-90827556 TCTGCCAAGGTGACCCTTTAAGG + Intergenic
1100458421 12:94775203-94775225 CATGCCAAGGAGAGCCCTGAAGG - Intergenic
1102631400 12:114283910-114283932 CTTGCCTAGGAGCCCCAGGATGG - Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104019544 12:124982455-124982477 CCTCCCTAGGGGGCCCTGGAGGG + Intronic
1105206789 13:18232467-18232489 CCTGTCAGCGAGGCCCTGGATGG - Intergenic
1105207236 13:18234576-18234598 CCTGTCAGCGAGGCCCTGGACGG - Intergenic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105465110 13:20632639-20632661 TCTGCCAAGGAGAGTCAGGAAGG - Intronic
1105858257 13:24389754-24389776 CCTGCCCAGGAGCCCCTGACGGG - Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1113016952 13:105838375-105838397 CCTGCCAATGAAACCCAGAAAGG - Intergenic
1113449779 13:110399763-110399785 CCTGCCAGGAAGATCCTGCAGGG - Intronic
1113964792 13:114146756-114146778 TCTGCGAGGGAGCCCCTGGAGGG + Intergenic
1114455240 14:22849613-22849635 GGTGCTAAGGAGACGCTGGACGG + Intergenic
1115804804 14:37038858-37038880 CCAGGCTAGGAGACCCTGGTCGG - Intronic
1119666477 14:76488700-76488722 CATGCCCAGGTGCCCCTGGATGG - Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121524983 14:94613413-94613435 ACTGCACAAGAGACCCTGGAAGG - Exonic
1122893942 14:104746131-104746153 CTAGGCAAGGAGGCCCTGGATGG + Intronic
1123049360 14:105533240-105533262 CATGGCCAGGTGACCCTGGAAGG - Intergenic
1127873073 15:63089380-63089402 CCTGCCCAGGAAGCTCTGGAAGG + Intergenic
1128226797 15:66007379-66007401 CCTGACAAGGAGAACCTAGCAGG - Intronic
1130076444 15:80694832-80694854 TCTGCAGAGGGGACCCTGGAGGG - Intronic
1132373479 15:101313315-101313337 CCAGCAAAGGAGTGCCTGGAGGG - Intronic
1132690212 16:1178727-1178749 CCTGCCCAGGAGCTCCTGGCCGG - Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134031500 16:10995904-10995926 TCGGCCTAGGAGAGCCTGGAAGG + Intronic
1135899439 16:26443345-26443367 TGTCCCCAGGAGACCCTGGAGGG + Intergenic
1136069855 16:27781221-27781243 CCAGCCCTGGAGACCCTCGAGGG + Intergenic
1136224422 16:28849131-28849153 CCAGCCTAGGAGACCCAGCAAGG - Intronic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1136677489 16:31925027-31925049 CTCTCCAAGGAGACTCTGGAGGG - Intergenic
1137595724 16:49722231-49722253 CCAGCCAAGCAGACCCAGGCTGG + Intronic
1138348698 16:56335171-56335193 CCCCCCAAGGTGACCTTGGAAGG - Intronic
1138460723 16:57146214-57146236 GCTGCCATGGAGTTCCTGGATGG + Exonic
1141609121 16:85171200-85171222 CCTGCCCAGGAAGCCCTGCACGG - Intergenic
1141683443 16:85556856-85556878 CCTGCCTGGGATTCCCTGGAAGG + Intergenic
1141741211 16:85894309-85894331 CCTTTCCAGGAGGCCCTGGAGGG + Intergenic
1141915547 16:87094063-87094085 TCTGGCAGGGAGACCCGGGATGG + Intronic
1143103082 17:4514688-4514710 CTAGCCAGGGAGACCCAGGAAGG - Intronic
1143625668 17:8109123-8109145 CCAGGCCAGGAGACCCTGGTGGG + Intronic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1148184210 17:45629896-45629918 CCTGCAGAAGAGACCCTGGAAGG - Intergenic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1148995102 17:51702669-51702691 TCTGCCATGGCCACCCTGGAAGG + Intronic
1149140871 17:53431505-53431527 ATTGCCAAGTATACCCTGGATGG - Intergenic
1152121519 17:78421808-78421830 CCTGCCTAGGACAGCCTCGAAGG - Intronic
1152596643 17:81240984-81241006 CAGGCCAAGAAGACGCTGGAGGG + Exonic
1152656027 17:81519577-81519599 CCTGCCCAGGAGCGCCAGGAGGG + Intronic
1152811619 17:82385336-82385358 GCAGCCAAGGAGACCCAGGCTGG + Intergenic
1152929138 17:83101089-83101111 TCTGCCCAGGAGACGCTGCAGGG + Intergenic
1153805401 18:8705655-8705677 CCGGCCATGGAGACACTGAACGG + Intronic
1155506117 18:26535071-26535093 CCTGCCAAGGGCATCATGGAGGG + Intronic
1156066150 18:33145741-33145763 ACTGTCAAGGAGACCATGAAGGG + Intronic
1157019437 18:43761766-43761788 CCTGCCAATGTGACCCTGTATGG - Intergenic
1157154897 18:45255829-45255851 TCTGCCAAGGACACCATTGAAGG - Intronic
1160908027 19:1460882-1460904 CCTATCAGGGACACCCTGGAAGG - Intronic
1160949441 19:1658459-1658481 CGTGGCAAGGCGTCCCTGGATGG - Intergenic
1161309783 19:3587105-3587127 CGTGCCAAGGAGCTCCTGGCAGG + Intronic
1161326665 19:3667551-3667573 CCTGCCATGGTCACCCTGGTTGG + Intronic
1161377985 19:3950007-3950029 CCTGCCTGGGAGGCACTGGAGGG + Intergenic
1161538270 19:4833322-4833344 CCAGCCCTGGAGACCCTGAAGGG - Intergenic
1161591018 19:5129116-5129138 CCTGCCAAGGACACCGTGGGCGG + Intronic
1162142869 19:8595319-8595341 CCAGACAGGGAGTCCCTGGAAGG + Intronic
1162461511 19:10816705-10816727 CCCACCCAGGGGACCCTGGAAGG - Intronic
1162958857 19:14114484-14114506 CCCCCCAAGAAGACCCTAGATGG - Intronic
1163578612 19:18124753-18124775 CTGGCCAAGGACCCCCTGGAGGG + Exonic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1163847658 19:19646559-19646581 GCTGCCATGGGGAGCCTGGATGG - Intronic
1163849924 19:19656966-19656988 GCTGCCAGGGAGACCCAGGTTGG - Intronic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1164418606 19:28067335-28067357 CTTGCCAAGGAGTCCCTGGATGG + Intergenic
1164418659 19:28067587-28067609 TCTGCCATGGAGCCACTGGATGG - Intergenic
1164522990 19:28992882-28992904 CCTCCCCAGGAGGCCCTGCATGG + Intergenic
1164713788 19:30377038-30377060 CCTGACATGGGGACCCTGGAAGG + Intronic
1165752440 19:38268524-38268546 CCTGCCCAGCAGTCCCTGGCAGG + Intronic
1166343613 19:42152363-42152385 CCTGCCAAGAAGGCCCCAGATGG + Intronic
1166443709 19:42839739-42839761 CCTGCCATGGAGACCTGGCAGGG - Intronic
1168250880 19:55141323-55141345 CCGTCCTAGGAGACCCTGGAGGG + Intronic
1168351408 19:55678257-55678279 CCTGGCAAGGCCACCCTGGGCGG - Intronic
1168474335 19:56665055-56665077 CCTGCAAGGGAGACCCTGCTGGG - Exonic
925065357 2:925628-925650 CCTGCCATGGATTCCCTGCAAGG - Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
927204540 2:20598956-20598978 CCTGACAAGGGGTCCCGGGAGGG + Intronic
927740760 2:25567741-25567763 CCTGCCAAGGAGTAACTAGATGG + Intronic
931022839 2:58069433-58069455 AGTACCAAGGAGACCATGGAGGG - Intronic
932088966 2:68787965-68787987 CCTGCCCAGGAAAGCCTGCAGGG - Intronic
932092908 2:68822663-68822685 CCTCCCCAGGGGACCCTGGCAGG - Exonic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
934122444 2:88853338-88853360 TCTGCCAAGGAAAACCAGGAAGG - Intergenic
934547963 2:95234458-95234480 GAGGCCAAGGAGACTCTGGACGG + Intronic
937266199 2:120616060-120616082 CCTGAGAAGGGGACCCTGGAGGG - Intergenic
937916001 2:127099016-127099038 CCTGCCCCGGCCACCCTGGAGGG - Intronic
942192472 2:173483736-173483758 CCTGCTCAGTAGACCCTTGATGG - Intergenic
942956422 2:181779538-181779560 ACTGACAAGGAGACCCTGTGTGG - Intergenic
944471102 2:200054867-200054889 CCTGGCATGGAGCTCCTGGAGGG + Intergenic
944946850 2:204697791-204697813 CCTGCAAGGGTGACCCTGGGTGG + Intronic
947437431 2:230084632-230084654 CCCAGCAAGTAGACCCTGGAAGG - Intergenic
948188712 2:236042198-236042220 CCGGCCAAGCCGACCCTGGCTGG - Intronic
948922972 2:241074545-241074567 CCTGCTGAAGAGACCCAGGAGGG - Intronic
1171134295 20:22683245-22683267 CCTTTCAAGGAACCCCTGGAAGG + Intergenic
1172589283 20:36105987-36106009 CCAGCTAAGGTGACCCTGGGAGG + Intronic
1175755984 20:61530491-61530513 CGTGGCAAGGGGACCCTGCACGG + Intronic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1176172947 20:63704397-63704419 CATGTCTAGGAGACCCTGGTGGG + Intronic
1176190888 20:63809113-63809135 CCTGCGAAGGGGAACGTGGAAGG - Intronic
1179479058 21:41666285-41666307 GCTGCCCAGGAGACCTTGGGTGG + Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1182279039 22:29207598-29207620 CCCACCCAGGAGACCCTGGGAGG - Intronic
1183936407 22:41264927-41264949 CCTTCCAAGGACACCCCGGCTGG + Intronic
1184037548 22:41925903-41925925 CCTGCCCCTGAGACCCTGGTCGG - Intronic
1184313544 22:43664779-43664801 CTGGCCTAGGAGACCCTGCATGG - Intronic
1185112019 22:48905438-48905460 CCTGGCCAGGAGACACTGCAGGG + Intergenic
1185232113 22:49689292-49689314 CCTCTCAAGGGGGCCCTGGAGGG - Intergenic
950017681 3:9765801-9765823 ATTGCCAAGGAGGCCCTGGAGGG - Exonic
950117550 3:10461314-10461336 TCTGCCAAGGAGACTCTGGGTGG - Intronic
953996073 3:47521060-47521082 TCTGTCAGGGAGACACTGGAAGG + Intergenic
954139091 3:48595757-48595779 CCTGTCAAGGAGATCCGGGTGGG - Intergenic
954305667 3:49724089-49724111 GCTGCCATGGAGACCCGGGCCGG + Intergenic
954369681 3:50163674-50163696 CTGGCCAAGGAGCCCCTGGGGGG - Intronic
954526898 3:51279931-51279953 TCTGCTAAGGAAAGCCTGGAGGG - Intronic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
959554635 3:107702622-107702644 CCTCCCACAGAGACCCTTGAGGG - Intronic
961178219 3:124853640-124853662 TCTTCCAAGTAGAACCTGGAAGG + Intronic
961326446 3:126112105-126112127 CCTCCCAAGGGGACTCAGGATGG + Intronic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
968435170 4:581686-581708 CCTGCAAAGGAGAACTTGGGGGG - Intergenic
968905389 4:3448393-3448415 CCTGCCCAGGGGTCCCTGGCTGG - Intronic
969350803 4:6596894-6596916 ACTGCCCAGAAAACCCTGGATGG - Intronic
971420003 4:26466260-26466282 CCTGCCTATGAGCCACTGGAGGG - Intergenic
972323546 4:37994091-37994113 CCTGCTCAGGAGGTCCTGGAAGG + Intronic
974503787 4:62740228-62740250 CATGCCAAGGCAACCCTGTAAGG - Intergenic
979152754 4:117341412-117341434 CCTTGGAAGGAGACCCTAGAGGG - Intergenic
979710588 4:123774248-123774270 CCTGCCATGAAGCCTCTGGAAGG + Intergenic
985272631 4:188208644-188208666 CCAGCCAAGGAGAGCCTGCGGGG - Intergenic
985820368 5:2156052-2156074 CCTGCCCTGGAGCCGCTGGAGGG - Intergenic
988486080 5:31669161-31669183 CCTGTCTGGGAGACCCAGGAGGG + Intronic
989448492 5:41559262-41559284 CTTGCTAATGAGACCCTAGAGGG + Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
991926563 5:71711016-71711038 CTAGACAAGGAGATCCTGGAGGG - Intergenic
992116186 5:73540577-73540599 CCTGCCAAAGATAACCTGGAAGG + Intergenic
996087878 5:119322662-119322684 CCTGCAAAGAAGACCAAGGAGGG - Intronic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
999112519 5:149134395-149134417 CTTGCCCTGGAGCCCCTGGAAGG + Intergenic
999478819 5:151925938-151925960 CCTGCTGCGGTGACCCTGGAGGG - Intergenic
999660402 5:153856609-153856631 TCTGCCAGGGAAACCCAGGATGG + Intergenic
1004135933 6:12966435-12966457 CCAGGCAAGGGGACCCTGGCTGG + Intronic
1005856895 6:29869622-29869644 CATGCCCAGAAGATCCTGGAGGG - Intergenic
1005858905 6:29886613-29886635 ACTGCCAAGGACATCCTGCAGGG - Intergenic
1013112250 6:107073410-107073432 CTTGGCAAGGAGACCCCAGAGGG - Intronic
1013216209 6:108029458-108029480 CCTGCCATGCAGACCAGGGATGG - Intergenic
1014466257 6:121760414-121760436 CTAGCCAAGGGAACCCTGGAGGG + Intergenic
1018262645 6:161985799-161985821 CCTGCCATGGAGACCCTTTGAGG + Intronic
1018391323 6:163343837-163343859 CCGGCCAAGGGCAGCCTGGATGG + Intergenic
1018931408 6:168242480-168242502 TCTGCCAAGGAGACCCTGTGTGG + Intergenic
1018972158 6:168537082-168537104 CATGCCAAGGAGACCCTGACTGG + Intronic
1019064793 6:169288003-169288025 CCTTCCATGGAGTCTCTGGAGGG - Intergenic
1019789417 7:3001262-3001284 CCTTGCAAGGACACCCTGGCGGG + Intronic
1021283860 7:18754713-18754735 ACTGCCGAGAAGACCCTGAAGGG - Intronic
1022857662 7:34331396-34331418 CTTGCAGAGGAGACCCTGCAAGG + Intergenic
1023736629 7:43241328-43241350 CCCACCAAAGAGAACCTGGATGG - Intronic
1024239204 7:47421036-47421058 CCTGCCAAGGTGACCCTGGGAGG - Intronic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1026644522 7:72156165-72156187 CAAACCAAGGAGAACCTGGAAGG + Intronic
1026767865 7:73171847-73171869 CCTGCCAAGGAGGGCCTGCCTGG - Intergenic
1027044333 7:74981555-74981577 CCTGCCAAGGAGGGCCTGCCTGG - Intronic
1027079308 7:75220803-75220825 CCTGCCAAGGAGGGCCTGCCTGG + Intergenic
1027410664 7:77914261-77914283 TCTGCCAAGGAGAGTCAGGAAGG + Intronic
1029126212 7:98296794-98296816 ACTGCAAAGGAGACCCACGAGGG + Intronic
1029388536 7:100259384-100259406 CCTGCCAAGGAGGGCCTGCCTGG + Intronic
1033047910 7:137979307-137979329 CCTGCCATCCTGACCCTGGAGGG - Intronic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1033547727 7:142416857-142416879 CCTGCCAATGATACCCTGATAGG - Intergenic
1034718729 7:153267649-153267671 CCTGGAAAGGAGACCCTTGCAGG - Intergenic
1034947947 7:155275905-155275927 CCTTCCAAGGAGACCAGGGTAGG + Intergenic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1036711883 8:11085095-11085117 GCTGCAGAGGAGACCCTGGAAGG - Intronic
1038216337 8:25564918-25564940 CCGGCCAAGAAGAGACTGGAAGG + Intergenic
1038249147 8:25886768-25886790 TCTGCAAAGGAGCCCCAGGAAGG - Exonic
1038436239 8:27538811-27538833 CATGCCGAGGGGACCCTGGTTGG - Intronic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1043519282 8:81026784-81026806 ACCTCCAAGGAGTCCCTGGAGGG + Intronic
1047465959 8:125114555-125114577 ACTGCCAAAGGAACCCTGGAGGG - Intronic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048857494 8:138697155-138697177 CCTTCCAGGGGGCCCCTGGAGGG - Intronic
1049093479 8:140534326-140534348 CATGCCCAGGAGGCCCTGGTGGG + Intronic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1049465037 8:142747244-142747266 TCTTCCAAGGTGACCCAGGATGG + Intergenic
1049536872 8:143186503-143186525 CCTGCCCAGGTGTCCCAGGAGGG + Intergenic
1049781097 8:144429308-144429330 CAGGCCCAGGGGACCCTGGACGG + Exonic
1055343309 9:75308611-75308633 CCTGGGATGGAGCCCCTGGAGGG - Intergenic
1058342237 9:103912594-103912616 CATGCCAAGGAGTGCCTGTAAGG + Intergenic
1058513716 9:105748074-105748096 CCTGCCAAGGTAACCCTGCTGGG + Exonic
1059993298 9:119885429-119885451 TCTACAAATGAGACCCTGGAGGG + Intergenic
1060184157 9:121553604-121553626 CCTGCCTACGAGACCCTCGGGGG + Intergenic
1060285437 9:122247569-122247591 CTTGCCATTGAGACACTGGATGG + Exonic
1061149407 9:128820416-128820438 TCTTCCCAGGAGACCCTGGGTGG + Exonic
1061251621 9:129429641-129429663 GCTGCCGGGGAGACCCTGCAGGG + Intergenic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1061865398 9:133489482-133489504 GCTGCCCAGCAGCCCCTGGAAGG - Intergenic
1062443679 9:136584514-136584536 GCTGTCAAGGATACCCTGGGAGG - Intergenic
1186392669 X:9176233-9176255 GCTGCCAAGTAGCCCCTGGAGGG + Intergenic
1193198125 X:78657786-78657808 GCAGCCCAGGAGTCCCTGGAGGG - Exonic
1198763084 X:140053989-140054011 CCTCCCAAGAAGCCCCTGCACGG - Intergenic