ID: 997642767

View in Genome Browser
Species Human (GRCh38)
Location 5:135460342-135460364
Sequence CGATGGCTGCTCCACAGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997642760_997642767 1 Left 997642760 5:135460318-135460340 CCAGGTGTGAGCAGCCCAGGGCC No data
Right 997642767 5:135460342-135460364 CGATGGCTGCTCCACAGTGTCGG No data
997642757_997642767 10 Left 997642757 5:135460309-135460331 CCTAATAGGCCAGGTGTGAGCAG No data
Right 997642767 5:135460342-135460364 CGATGGCTGCTCCACAGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997642767 Original CRISPR CGATGGCTGCTCCACAGTGT CGG Intergenic