ID: 997642767 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:135460342-135460364 |
Sequence | CGATGGCTGCTCCACAGTGT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997642760_997642767 | 1 | Left | 997642760 | 5:135460318-135460340 | CCAGGTGTGAGCAGCCCAGGGCC | No data | ||
Right | 997642767 | 5:135460342-135460364 | CGATGGCTGCTCCACAGTGTCGG | No data | ||||
997642757_997642767 | 10 | Left | 997642757 | 5:135460309-135460331 | CCTAATAGGCCAGGTGTGAGCAG | No data | ||
Right | 997642767 | 5:135460342-135460364 | CGATGGCTGCTCCACAGTGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997642767 | Original CRISPR | CGATGGCTGCTCCACAGTGT CGG | Intergenic | ||