ID: 997643373

View in Genome Browser
Species Human (GRCh38)
Location 5:135464308-135464330
Sequence TCGCAGCATGGCTGGAGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997643373_997643377 4 Left 997643373 5:135464308-135464330 CCCGTGCTCCAGCCATGCTGCGA No data
Right 997643377 5:135464335-135464357 TCAACACCCACATTTGTAACAGG No data
997643373_997643382 23 Left 997643373 5:135464308-135464330 CCCGTGCTCCAGCCATGCTGCGA No data
Right 997643382 5:135464354-135464376 CAGGGTGTTCTAGCCAAGATGGG No data
997643373_997643381 22 Left 997643373 5:135464308-135464330 CCCGTGCTCCAGCCATGCTGCGA No data
Right 997643381 5:135464353-135464375 ACAGGGTGTTCTAGCCAAGATGG No data
997643373_997643378 5 Left 997643373 5:135464308-135464330 CCCGTGCTCCAGCCATGCTGCGA No data
Right 997643378 5:135464336-135464358 CAACACCCACATTTGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997643373 Original CRISPR TCGCAGCATGGCTGGAGCAC GGG (reversed) Intergenic
No off target data available for this crispr