ID: 997647171

View in Genome Browser
Species Human (GRCh38)
Location 5:135489287-135489309
Sequence CCCTCGGACTTGGGGAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997647159_997647171 -6 Left 997647159 5:135489270-135489292 CCAGACTTGCCCCGCGCCCCTCG No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data
997647156_997647171 3 Left 997647156 5:135489261-135489283 CCGTCTTCCCCAGACTTGCCCCG No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data
997647155_997647171 29 Left 997647155 5:135489235-135489257 CCAGTCTCGCGAGTGGAGAGGGC No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data
997647158_997647171 -5 Left 997647158 5:135489269-135489291 CCCAGACTTGCCCCGCGCCCCTC No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data
997647153_997647171 30 Left 997647153 5:135489234-135489256 CCCAGTCTCGCGAGTGGAGAGGG No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data
997647157_997647171 -4 Left 997647157 5:135489268-135489290 CCCCAGACTTGCCCCGCGCCCCT No data
Right 997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997647171 Original CRISPR CCCTCGGACTTGGGGAGGGT AGG Intergenic
No off target data available for this crispr