ID: 997647210

View in Genome Browser
Species Human (GRCh38)
Location 5:135489424-135489446
Sequence CCTTGCGCGCCTGTTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997647205_997647210 -5 Left 997647205 5:135489406-135489428 CCCAGGATGGGCGCCTGGCCTTG No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647206_997647210 -6 Left 997647206 5:135489407-135489429 CCAGGATGGGCGCCTGGCCTTGC No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647197_997647210 9 Left 997647197 5:135489392-135489414 CCCTCCTAGGGTCCCCCAGGATG No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647201_997647210 5 Left 997647201 5:135489396-135489418 CCTAGGGTCCCCCAGGATGGGCG No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647204_997647210 -4 Left 997647204 5:135489405-135489427 CCCCAGGATGGGCGCCTGGCCTT No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647194_997647210 15 Left 997647194 5:135489386-135489408 CCTCACCCCTCCTAGGGTCCCCC No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647203_997647210 -3 Left 997647203 5:135489404-135489426 CCCCCAGGATGGGCGCCTGGCCT No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647198_997647210 8 Left 997647198 5:135489393-135489415 CCTCCTAGGGTCCCCCAGGATGG No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data
997647196_997647210 10 Left 997647196 5:135489391-135489413 CCCCTCCTAGGGTCCCCCAGGAT No data
Right 997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997647210 Original CRISPR CCTTGCGCGCCTGTTCCCCT GGG Intergenic
No off target data available for this crispr