ID: 997647232

View in Genome Browser
Species Human (GRCh38)
Location 5:135489497-135489519
Sequence GCCCCTGTCCGGCCGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997647217_997647232 25 Left 997647217 5:135489449-135489471 CCACTTCGTCTCCCTGGGTGTCG No data
Right 997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG No data
997647222_997647232 14 Left 997647222 5:135489460-135489482 CCCTGGGTGTCGGGACTGGAGGG No data
Right 997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG No data
997647224_997647232 13 Left 997647224 5:135489461-135489483 CCTGGGTGTCGGGACTGGAGGGA No data
Right 997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997647232 Original CRISPR GCCCCTGTCCGGCCGGAGGG AGG Intergenic
No off target data available for this crispr