ID: 997647475

View in Genome Browser
Species Human (GRCh38)
Location 5:135490803-135490825
Sequence AAGGTGGAAGGGGCTTTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997647475_997647482 -3 Left 997647475 5:135490803-135490825 CCCGGAAAAGCCCCTTCCACCTT No data
Right 997647482 5:135490823-135490845 CTTTGCCCTCTTCCCCGCTCTGG No data
997647475_997647483 -2 Left 997647475 5:135490803-135490825 CCCGGAAAAGCCCCTTCCACCTT No data
Right 997647483 5:135490824-135490846 TTTGCCCTCTTCCCCGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997647475 Original CRISPR AAGGTGGAAGGGGCTTTTCC GGG (reversed) Intergenic