ID: 997653457

View in Genome Browser
Species Human (GRCh38)
Location 5:135538535-135538557
Sequence CTCAAAAAACAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997653457_997653465 25 Left 997653457 5:135538535-135538557 CCTTGTTCCATCTGTTTTTTGAG No data
Right 997653465 5:135538583-135538605 TTGCATGAGCCCTCCCATAGCGG No data
997653457_997653466 26 Left 997653457 5:135538535-135538557 CCTTGTTCCATCTGTTTTTTGAG No data
Right 997653466 5:135538584-135538606 TGCATGAGCCCTCCCATAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997653457 Original CRISPR CTCAAAAAACAGATGGAACA AGG (reversed) Intergenic
No off target data available for this crispr