ID: 997654535

View in Genome Browser
Species Human (GRCh38)
Location 5:135545396-135545418
Sequence CACAGGGGCCTGGTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997654535_997654553 24 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654553 5:135545443-135545465 CCGGGTTAATTCCAAGTGTTTGG No data
997654535_997654547 -2 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654547 5:135545417-135545439 TGGCTGCCTGGGGATGGCGGTGG No data
997654535_997654549 5 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654549 5:135545424-135545446 CTGGGGATGGCGGTGGCCTCCGG No data
997654535_997654546 -5 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654546 5:135545414-135545436 CTGTGGCTGCCTGGGGATGGCGG No data
997654535_997654543 -8 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654543 5:135545411-135545433 CCCCTGTGGCTGCCTGGGGATGG No data
997654535_997654550 6 Left 997654535 5:135545396-135545418 CCCAGGGAAACCAGGCCCCTGTG No data
Right 997654550 5:135545425-135545447 TGGGGATGGCGGTGGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997654535 Original CRISPR CACAGGGGCCTGGTTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr