ID: 997655451

View in Genome Browser
Species Human (GRCh38)
Location 5:135550895-135550917
Sequence ACACTTCTGATCACAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997655445_997655451 11 Left 997655445 5:135550861-135550883 CCCATGAGAAAACAGACCCCAGT No data
Right 997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG No data
997655446_997655451 10 Left 997655446 5:135550862-135550884 CCATGAGAAAACAGACCCCAGTC No data
Right 997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG No data
997655447_997655451 -5 Left 997655447 5:135550877-135550899 CCCCAGTCACATAAATACACACT No data
Right 997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG No data
997655448_997655451 -6 Left 997655448 5:135550878-135550900 CCCAGTCACATAAATACACACTT No data
Right 997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG No data
997655449_997655451 -7 Left 997655449 5:135550879-135550901 CCAGTCACATAAATACACACTTC No data
Right 997655451 5:135550895-135550917 ACACTTCTGATCACAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997655451 Original CRISPR ACACTTCTGATCACAGCAGG TGG Intergenic
No off target data available for this crispr