ID: 997657610

View in Genome Browser
Species Human (GRCh38)
Location 5:135566990-135567012
Sequence CTGTTGGTCTGACTGCCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997657610_997657618 26 Left 997657610 5:135566990-135567012 CCGTCTGGCAGTCAGACCAACAG No data
Right 997657618 5:135567039-135567061 CCTGTAGACTGAGTTTCTGGAGG No data
997657610_997657615 23 Left 997657610 5:135566990-135567012 CCGTCTGGCAGTCAGACCAACAG No data
Right 997657615 5:135567036-135567058 CTCCCTGTAGACTGAGTTTCTGG No data
997657610_997657619 27 Left 997657610 5:135566990-135567012 CCGTCTGGCAGTCAGACCAACAG No data
Right 997657619 5:135567040-135567062 CTGTAGACTGAGTTTCTGGAGGG No data
997657610_997657620 28 Left 997657610 5:135566990-135567012 CCGTCTGGCAGTCAGACCAACAG No data
Right 997657620 5:135567041-135567063 TGTAGACTGAGTTTCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997657610 Original CRISPR CTGTTGGTCTGACTGCCAGA CGG (reversed) Intergenic
No off target data available for this crispr