ID: 997657901

View in Genome Browser
Species Human (GRCh38)
Location 5:135568861-135568883
Sequence CCCTGGTATGCACTGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997657894_997657901 -2 Left 997657894 5:135568840-135568862 CCTCTGCTCTGCCCTGCCCTGCC No data
Right 997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG No data
997657893_997657901 14 Left 997657893 5:135568824-135568846 CCAGCAAGAGGCTTGGCCTCTGC No data
Right 997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG No data
997657892_997657901 15 Left 997657892 5:135568823-135568845 CCCAGCAAGAGGCTTGGCCTCTG No data
Right 997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997657901 Original CRISPR CCCTGGTATGCACTGTCTTC TGG Intergenic
No off target data available for this crispr