ID: 997658283

View in Genome Browser
Species Human (GRCh38)
Location 5:135571321-135571343
Sequence CCACAGTGGCCCCTGTAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997658283_997658286 -10 Left 997658283 5:135571321-135571343 CCCGGCTACAGGGGCCACTGTGG 0: 1
1: 0
2: 2
3: 27
4: 309
Right 997658286 5:135571334-135571356 GCCACTGTGGAGTCACACTGAGG 0: 1
1: 0
2: 3
3: 11
4: 202
997658283_997658289 13 Left 997658283 5:135571321-135571343 CCCGGCTACAGGGGCCACTGTGG 0: 1
1: 0
2: 2
3: 27
4: 309
Right 997658289 5:135571357-135571379 CTGTGACCGGCCATAAGCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 68
997658283_997658292 24 Left 997658283 5:135571321-135571343 CCCGGCTACAGGGGCCACTGTGG 0: 1
1: 0
2: 2
3: 27
4: 309
Right 997658292 5:135571368-135571390 CATAAGCCCAGGAGAGCCCGTGG 0: 1
1: 0
2: 0
3: 19
4: 183
997658283_997658288 0 Left 997658283 5:135571321-135571343 CCCGGCTACAGGGGCCACTGTGG 0: 1
1: 0
2: 2
3: 27
4: 309
Right 997658288 5:135571344-135571366 AGTCACACTGAGGCTGTGACCGG 0: 1
1: 0
2: 4
3: 18
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997658283 Original CRISPR CCACAGTGGCCCCTGTAGCC GGG (reversed) Exonic
900739716 1:4323276-4323298 CCACAGGGCCCTCTGGAGCCTGG + Intergenic
901441990 1:9283543-9283565 TCACACAGGCCCCTGCAGCCGGG + Intergenic
902400814 1:16155788-16155810 CCCCAGTGCCCCCTAGAGCCCGG - Intronic
903182996 1:21614544-21614566 ACTCTGTGGCCCCTGAAGCCAGG + Intronic
904012190 1:27396078-27396100 CCACAGTGGCCGGTGTGGGCAGG - Intergenic
904170247 1:28586728-28586750 CCTCAGTGTCCCGTGTAGCTGGG - Intergenic
904212502 1:28895218-28895240 CCACTGTGGCCCAGGGAGCCTGG + Intronic
904351135 1:29907416-29907438 GCACAGTGGCCTCTGCTGCCTGG + Intergenic
904478607 1:30780126-30780148 CCTCAGTGTCCCCAGTAGCTGGG + Intergenic
906995819 1:50793125-50793147 CCACAGTGGTCACTGAAGTCAGG - Intronic
907206962 1:52781381-52781403 CCTCAGTGTCCCATGTAGCTGGG - Intronic
911190762 1:94946320-94946342 CCACAGTAGCCCCCGTAGCTAGG + Intergenic
912044458 1:105437137-105437159 CCACAGTGCCCACTGCACCCAGG - Intergenic
915081414 1:153355170-153355192 CCACTGTGGCTCCTCTAGGCAGG - Intergenic
915355066 1:155250901-155250923 GCACAGTGGCCCCTAGAGGCTGG - Intronic
915674266 1:157515857-157515879 CCACAGTGGCCTCTGACCCCAGG - Exonic
916602658 1:166307994-166308016 CAACCGTGGCCGCTGTGGCCTGG + Intergenic
917693059 1:177488804-177488826 CCACACTGCCCCATGTACCCTGG - Intergenic
918082608 1:181218993-181219015 CCACAGTGCCTCCTAGAGCCTGG - Intergenic
918312107 1:183292337-183292359 CCACACTGGCCCCAGGAGACAGG - Intronic
920849457 1:209618752-209618774 CCACAGTGGCCCCTCTACCGTGG + Intronic
921232144 1:213083741-213083763 CCCCAGTGGTCCCTGTCTCCTGG + Intronic
922548933 1:226479677-226479699 CCCCAGTTGCTCCTGTAGCTTGG + Intergenic
922744771 1:228037684-228037706 CCAGAGAGGCCGCTGGAGCCAGG - Intronic
923345383 1:233046608-233046630 CCAAAGTGACCCTTATAGCCAGG + Intronic
923713139 1:236403069-236403091 CCTCAGTGTCCCCAGTAGCTGGG + Intronic
1063417258 10:5884042-5884064 CCACAGTTGTCTCTGTAGTCTGG + Exonic
1063748442 10:8914060-8914082 CCTCAGTCTCCCCTGTAGCTGGG + Intergenic
1065306429 10:24373434-24373456 TCAGAGTGGCCTCTGTAGCATGG + Intronic
1067030257 10:42875064-42875086 CTACTGTGGCCCCTCCAGCCTGG - Intergenic
1067083688 10:43227359-43227381 CCCCAGTGCCCCCTGCATCCTGG + Intronic
1069556770 10:69403372-69403394 CCTCAGTCTCCCCTGTAGCTGGG - Intergenic
1069894586 10:71672606-71672628 CCACAGTGACCCTTGTCCCCAGG - Intronic
1070977844 10:80619613-80619635 CCACAGTGGCTGCTGCAGCCAGG - Intronic
1071610373 10:87026496-87026518 CTACAGTGGACCTTGTATCCTGG + Intergenic
1071709045 10:88030875-88030897 CGACAGTGGGTCCTGCAGCCTGG - Intergenic
1072741800 10:97914293-97914315 GCACAGTGCTCCCTGTACCCAGG + Intronic
1073099108 10:100997846-100997868 GCACAGCGCCCCCTGGAGCCGGG + Intronic
1075903475 10:126062012-126062034 CCACTGTGGCCCTTGATGCCAGG - Intronic
1076235341 10:128860161-128860183 CCCCAGTGGCCTCTTTTGCCAGG + Intergenic
1076790935 10:132776393-132776415 CCACAGGCGCCCCTGTGGGCAGG + Intronic
1076877984 10:133225912-133225934 CCACATTGGCCTCTGCAGCTGGG + Exonic
1077024189 11:432087-432109 CCACAGTGGACCCTGCCTCCAGG + Intronic
1077199820 11:1300792-1300814 CCACAGTCGCCCCTGAAGCACGG + Intronic
1077519817 11:3025935-3025957 ACATAGTGGCCCCTGGGGCCTGG - Intronic
1077707113 11:4497467-4497489 CCTCAGGCTCCCCTGTAGCCTGG - Intergenic
1079083822 11:17431390-17431412 CCACAGTTCCCCCAGGAGCCAGG + Intronic
1080446975 11:32346208-32346230 TCACTGTGGCCCCTGTGACCAGG - Intergenic
1080615545 11:33942024-33942046 CCACTGTGGCCCCACTAGCAGGG - Intergenic
1084063709 11:66691532-66691554 CCACGGTGGCCCGTGCAGCATGG + Exonic
1085326654 11:75611380-75611402 CTGCAGTGGCCCCTGTGGGCTGG + Intronic
1086412243 11:86554254-86554276 CCACTCTGGCCCCTATTGCCAGG - Intronic
1086731659 11:90257354-90257376 CCACAGTGGCACCTGCAGTATGG + Intergenic
1089275591 11:117333642-117333664 CCTCAGTCTCCCCTGTAGCTGGG + Intronic
1089790836 11:120942357-120942379 CCACATTGACCCCTGGAGTCGGG + Intronic
1089798126 11:120999800-120999822 CCACAGAGGCCCCTGTGGCAAGG - Intergenic
1090457774 11:126864811-126864833 CCAAAGTAGCCCTTGTGGCCTGG - Intronic
1091073249 11:132588770-132588792 CCACAGCTTCACCTGTAGCCAGG + Intronic
1091529859 12:1343955-1343977 CCTCAGTGTCCCGTGTAGCTGGG + Intronic
1091737583 12:2935850-2935872 CCTCAGTGCCCCCAGTAGCTGGG - Intronic
1092109419 12:5948438-5948460 CCATAGTGGCCCCTGTGGGAGGG - Intergenic
1093173007 12:15880109-15880131 CCTCAGTGTCCCGTGTAGCTGGG + Intronic
1094139986 12:27171470-27171492 CCATAGTGGCCCCTTTCGCTAGG + Intergenic
1094525209 12:31226807-31226829 CCCCAGCTGCCCCTGTAACCGGG - Intergenic
1096083974 12:48852701-48852723 CAACCTTGGCCCCTGCAGCCGGG + Intronic
1096092851 12:48914972-48914994 CCTCAGTGTCCCCAGTAGCTGGG + Intronic
1096101526 12:48972900-48972922 CAACAGTGACCCCTGCAGCACGG - Intergenic
1096191635 12:49623634-49623656 CCACAGCGCCCCCTGCGGCCCGG + Intronic
1098442632 12:70534498-70534520 CCACAGTGGGCCCAGCACCCGGG + Exonic
1098521561 12:71439840-71439862 CCACTGTCGCCGCTGCAGCCAGG + Exonic
1099107862 12:78519040-78519062 CCCCAGTCGCCCCTGGAACCGGG + Intergenic
1099557455 12:84128322-84128344 CCACAGAGCCACCTGGAGCCAGG + Intergenic
1101282324 12:103271129-103271151 CCACAGTGACCCCTGTAAAGTGG + Intronic
1102600382 12:114025292-114025314 CCCCAGTGGTCCCTGTTTCCTGG + Intergenic
1102865673 12:116372192-116372214 CCACATCGGCCTCTGTAGCTGGG - Intergenic
1102904218 12:116662060-116662082 ACTCAGTGGCCTCTGTACCCCGG - Intergenic
1103742398 12:123099675-123099697 ACACAGTGGGACCTGGAGCCAGG - Intronic
1103894809 12:124265811-124265833 CCACAGTGGCCCAAGGAGGCAGG + Intronic
1104529214 12:129553241-129553263 CCACAGTGGCCCGTGGTCCCTGG + Intronic
1107207202 13:37806865-37806887 CCACAGTGGGCGCTGTCTCCTGG + Intronic
1107471393 13:40694823-40694845 CCTCAGTCTCCCCTGTAGCTGGG + Intergenic
1108366003 13:49713817-49713839 CCTCAGTGCCCCATGTAGCTGGG + Intronic
1109687657 13:65843226-65843248 TCACAGTGGCTGCTGTAGACAGG - Intergenic
1112543660 13:100342835-100342857 CCTCAGTGTCCCTGGTAGCCAGG + Intronic
1113445495 13:110363204-110363226 CCACAGTGCCCCCTGTGGCCTGG + Intronic
1116448085 14:45035242-45035264 CCCCAGTCGCCCCAGTAGCTGGG - Intronic
1116763682 14:49045374-49045396 CCACACTGGCAACTGTAACCCGG - Intergenic
1118440129 14:65804544-65804566 ACACAGGGGCCCCCTTAGCCTGG - Intergenic
1120997758 14:90429295-90429317 CCCCTGTAGCCCCTTTAGCCTGG + Intergenic
1122119639 14:99545237-99545259 GCCCAGTGGCCCCTGAAGCTGGG - Intronic
1122176033 14:99919866-99919888 CCACAGGAGCCCCCCTAGCCAGG - Intronic
1122461668 14:101900861-101900883 CTGCAGTGGCAGCTGTAGCCAGG - Intronic
1122945423 14:105006403-105006425 CCACAGTGCCCTCTGTCCCCAGG + Intronic
1123069740 14:105636634-105636656 CCACAGAGACCTCTGTATCCTGG + Intergenic
1123088822 14:105732353-105732375 CCACAGAGACCTCTGTATCCTGG + Intergenic
1123565569 15:21543141-21543163 CCAGGGTGGCTCCTGGAGCCTGG + Intergenic
1124634867 15:31358870-31358892 GCACACTGGCTCCTGAAGCCAGG + Intronic
1128184215 15:65630541-65630563 CCAAAGGGCCCACTGTAGCCTGG + Intronic
1128549614 15:68589954-68589976 CCACAGTGGCCCGTGACCCCCGG + Intronic
1128715013 15:69901473-69901495 GCACATTGGCCCCTCTGGCCAGG - Intergenic
1129262803 15:74378199-74378221 CCCCAGTGTCCTCTCTAGCCTGG - Intergenic
1129785662 15:78308548-78308570 CCACAGTGGAGCCACTAGCCAGG + Intergenic
1131032738 15:89200004-89200026 CCACAGTGGCCCTTGGAAGCAGG + Exonic
1132517311 16:371735-371757 CTGCAGTGGCCCCTGGGGCCTGG - Exonic
1132647185 16:1004474-1004496 CCAGAGAGACCCCTGGAGCCGGG + Intergenic
1132648549 16:1010188-1010210 CCACAGTGGACACAGTAGCCTGG - Intergenic
1132802982 16:1763273-1763295 CCACGGTGGCCTCTGCAGCAAGG + Intronic
1133212971 16:4273269-4273291 CCATAGTGGCGCATGTAGCTCGG - Intergenic
1133322767 16:4924663-4924685 CCACTGTGCCCACTGGAGCCTGG + Intronic
1133765077 16:8832319-8832341 CCAGAGAGGCTCCTGCAGCCAGG + Intronic
1134021030 16:10921846-10921868 TCTCAGTGTCCCCTGCAGCCTGG - Intronic
1134135439 16:11673839-11673861 CCTCAGGGGCCACTGCAGCCAGG - Intronic
1135061506 16:19275064-19275086 CAGCAGTGGCCACTGTAGCCAGG + Intergenic
1136664217 16:31794016-31794038 GCACAGAGGCCCCTGGAGCCAGG - Intronic
1137035587 16:35566939-35566961 TCACAGTGCCCACTGTAGGCAGG + Intergenic
1137723196 16:50639786-50639808 CCACAGTGGCCCCTGGTGCATGG + Exonic
1139372729 16:66478934-66478956 CCACTGTGCCCTCTGTAGCGTGG - Intronic
1139661057 16:68421176-68421198 ACACAGGGGCCCCTGGAGTCAGG + Intronic
1139911697 16:70401202-70401224 CCGCAGTGGCCACTGAAGGCGGG + Intronic
1140224657 16:73067700-73067722 ACTCAGTGGCCCCTGCAGCTTGG + Intergenic
1141180199 16:81747417-81747439 CCTCAGTGTCCCGTGTAGCTGGG - Intronic
1142744293 17:1948038-1948060 CCCCAGTGGACCCTGGACCCTGG + Intronic
1142965528 17:3578529-3578551 CCTCAGTGTCCCCAGTAGCTGGG - Intronic
1143680024 17:8469496-8469518 ACACGTGGGCCCCTGTAGCCAGG - Intronic
1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG + Intergenic
1145413284 17:22692727-22692749 TCACAGTGGCCACCGTTGCCTGG + Intergenic
1147931351 17:43983537-43983559 CTGCAGTGCCCCCTGTAGCCAGG - Intronic
1149681012 17:58507177-58507199 CCCCAGTGGCCCTTGTCCCCGGG + Exonic
1149740038 17:59036596-59036618 CCACAGTCTCCCAAGTAGCCAGG + Intronic
1150283583 17:63943438-63943460 CCCCAGTGGCCCCTGGGGCAAGG - Intronic
1150290425 17:63978364-63978386 CCATAGTGGCCTCTCTGGCCTGG + Intergenic
1152039583 17:77894283-77894305 ACACAGTGGCCCTTGTGGCTGGG + Intergenic
1152710114 17:81867200-81867222 CCTCCGTGGCCCCCGTTGCCTGG + Intergenic
1156294029 18:35773881-35773903 CCTCAGGGGCCCCAGCAGCCTGG + Intergenic
1157722926 18:49939259-49939281 CCTCAGTGTCCCCAGTAGCTGGG + Intronic
1159385920 18:67725629-67725651 CCACAGCGGCCCCTTTCCCCAGG + Intergenic
1160029276 18:75244507-75244529 TGACAGTGGCCCCTGTTGGCTGG + Intronic
1160505808 18:79426396-79426418 GGACAGTGGCCCCCGTGGCCTGG - Intronic
1160619653 18:80161826-80161848 CCAGACTGACCCCTGGAGCCTGG - Intronic
1160845360 19:1163864-1163886 CGGCAGTGGCCCCGGTTGCCTGG + Intronic
1160889609 19:1370424-1370446 CCTCACTGGGCCCTGCAGCCAGG - Intronic
1160982878 19:1824241-1824263 CTCCAGTGTCCTCTGTAGCCCGG - Intronic
1161631761 19:5360475-5360497 CCACAGTGACATCTGTACCCTGG - Intergenic
1162504392 19:11074461-11074483 CCTCAGTCTCCCGTGTAGCCTGG - Intergenic
1163512746 19:17745691-17745713 CCTCAGTGTCCCAAGTAGCCGGG - Intergenic
1164089402 19:21934673-21934695 TCACAATGGCCACTGTAGGCAGG - Intronic
1164249068 19:23461097-23461119 CCACAATGCCCCCTGTGGGCAGG - Intergenic
1164285979 19:23818201-23818223 CCACAGAGGCTCTTGTAACCAGG - Intronic
1164294628 19:23898937-23898959 CCACAATGTCCCCTGTAGGAAGG - Intergenic
1164314013 19:24070963-24070985 CAAAATTGGCCCCTGTAGTCAGG - Intronic
1164325264 19:24185802-24185824 TCACAGTGCCTCCTGTAGGCAGG + Intergenic
1164828312 19:31300662-31300684 CTACAGTGGCCCCACAAGCCTGG + Intronic
1164910570 19:32008012-32008034 CAATAATGGCCCCTGTGGCCAGG + Intergenic
1165078877 19:33296555-33296577 CCACAGTGCACCCTGGATCCTGG - Intergenic
1165460042 19:35939073-35939095 CCTCAGTGTCCCATGTAGCTAGG + Intronic
1166518040 19:43461740-43461762 GCTCAGTGGCTCCTGTTGCCAGG - Exonic
1166797497 19:45436102-45436124 CCACAGTGACCCACGGAGCCTGG + Intronic
1166889688 19:45983067-45983089 AAAGAATGGCCCCTGTAGCCAGG - Intergenic
1167361833 19:49034163-49034185 CCACAGTGGCCTCCGAAGCCTGG + Intronic
1167363046 19:49040305-49040327 CCACAGTGGTCCCCGAAGCCTGG + Intergenic
1167364247 19:49046689-49046711 CCACAGTGGCCCCCGAAGCCTGG - Intergenic
1167365517 19:49053281-49053303 CCACAGTGGTCCCCGAAGCCTGG - Intergenic
1167392843 19:49207902-49207924 CGACAGTGGCCCCTAATGCCTGG + Intronic
1168295769 19:55376822-55376844 CCACAGTGGCCCCAGGGGTCTGG + Exonic
1168508736 19:56957817-56957839 CCTCAGTGTCCCCAGTAGCTGGG - Intergenic
1168678815 19:58298924-58298946 CCTCAGCCGCCCCTGTAGCTGGG + Exonic
925309892 2:2875023-2875045 CCACAGTGTCACCCGCAGCCCGG + Intergenic
925671102 2:6310772-6310794 ACACAGAGGCTCCTGCAGCCGGG - Intergenic
927211342 2:20640868-20640890 CCACAGCTGCCTCTGCAGCCTGG - Intronic
927975598 2:27336005-27336027 ACAAAGTGGGCCCTGTTGCCAGG + Exonic
931391971 2:61852075-61852097 CCACAGTGGGCCTGATAGCCAGG - Intronic
932305984 2:70704582-70704604 GCTCAGTGTCCCCTGTAGCTGGG - Intronic
932926832 2:75985892-75985914 TCACAGTGGCCCATGTAGCAAGG - Intergenic
935255864 2:101308888-101308910 CCACGGCGGACCCTGTGGCCAGG + Intergenic
935807265 2:106761385-106761407 CCTCAGTGCCCCCAGTAGCTGGG - Intergenic
936462611 2:112723842-112723864 CCACTGTGTCCCCTGGGGCCAGG - Intronic
937861513 2:126714984-126715006 CCACACTGGCCCCAGCAACCAGG + Intergenic
939069198 2:137518713-137518735 CCACAGTGGCCATTGTGGCAGGG + Intronic
940999066 2:160181532-160181554 CCACAGTCGCCCCTTTCCCCAGG - Intronic
942811240 2:180003612-180003634 CTACAGAGGCTCCTGTAGCCAGG + Intronic
946180927 2:217948472-217948494 CTAGAGTGGCCCCTGGGGCCTGG - Intronic
947083206 2:226421533-226421555 CCACAGTGTCCCAAGTAGCTGGG + Intergenic
947770577 2:232667191-232667213 ATACAGTGGCCCCTGGAGCCTGG + Intronic
948231878 2:236354949-236354971 CCAGGGTGGGCCATGTAGCCGGG - Intronic
948421503 2:237863209-237863231 CCACCAGGGCCACTGTAGCCCGG - Intronic
948430915 2:237918389-237918411 CCACAGTCTCCCCAGTAGCTGGG + Intergenic
948611903 2:239175316-239175338 CCACGGTGGACCCTGCACCCCGG + Intronic
948756513 2:240162686-240162708 CCAGAGTGGCTCCAGAAGCCAGG - Intergenic
1168977186 20:1975602-1975624 GCACAGTGGCCTTTGTAGCATGG + Intergenic
1169969961 20:11259386-11259408 CCCCAGTGTCCCCAGTAGCTGGG + Intergenic
1169972021 20:11278555-11278577 CCTCAGGGCCCCATGTAGCCTGG + Intergenic
1171019937 20:21575913-21575935 CCCCAGTGGCCCCTTGAGACAGG + Intergenic
1171782957 20:29437809-29437831 TCACAGTGCCCCTTGTAGGCAGG + Intergenic
1173045954 20:39512131-39512153 CCACAGTGGCCCCTGGACCACGG + Intergenic
1173269160 20:41516273-41516295 CCTCAGTCTCCCCTGTAGCTGGG + Intronic
1175834306 20:61983545-61983567 CCTCAGCCGCCCCAGTAGCCTGG - Intronic
1175976026 20:62710930-62710952 CCACCCTGGCCCCTCTAGCTGGG - Intronic
1176161574 20:63651425-63651447 CCACAGTGGCCTCTGACCCCTGG + Intronic
1176889547 21:14298073-14298095 CCACAGTGGAACATATAGCCAGG - Intergenic
1179302220 21:40122865-40122887 CCACAGGTGCCCCTGAGGCCTGG - Intronic
1180008391 21:45033858-45033880 CCTCAGTGGCCCCGCTAACCTGG + Intergenic
1180595443 22:16969997-16970019 CCACAGAATCCCCTGGAGCCTGG - Exonic
1180825218 22:18856800-18856822 CCACAGGGGCACCTGCAGGCTGG + Intronic
1181149290 22:20871365-20871387 CCTCAGTCTCCCCTGTAGCTAGG - Intronic
1181187511 22:21117747-21117769 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1181211687 22:21292746-21292768 CCACAGGGGCACCTGCAGGCTGG + Intergenic
1181397822 22:22634140-22634162 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1181409159 22:22705904-22705926 CCACAGGGGCAGCTGTAGCATGG + Intergenic
1181500567 22:23313510-23313532 CCACAGGGGCACCTGCAGGCTGG - Intronic
1181633442 22:24163417-24163439 CTGCAGTGGTCCCTGTAGCTGGG + Intronic
1181651587 22:24261918-24261940 CCACAGGGGCACCTGCAGGCTGG + Intergenic
1181705788 22:24648821-24648843 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1184238529 22:43199590-43199612 CCACCGTGAGCCCTGCAGCCTGG + Exonic
1184601605 22:45547098-45547120 CAGCAGCAGCCCCTGTAGCCAGG + Exonic
1184605824 22:45574356-45574378 CGACAGTGGTCTCTGCAGCCTGG - Intronic
1203215266 22_KI270731v1_random:2686-2708 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1203275364 22_KI270734v1_random:82703-82725 CCACAGGGGCACCTGCAGGCTGG + Intergenic
949548421 3:5092277-5092299 CCTGAGTGGCCCCTCTATCCTGG + Intergenic
949873273 3:8607342-8607364 CCACACTGGCTTCTGCAGCCCGG + Intergenic
949963488 3:9334970-9334992 CCTCCCTGGCCCCTGTAGGCAGG - Intronic
950673734 3:14541939-14541961 CCAGAGTGGCCTCTGTGCCCTGG - Exonic
951721950 3:25709853-25709875 CCACAGAGGCACCTGTAATCAGG - Intergenic
951882263 3:27490840-27490862 CCTCAGTGTCCCCAGTAGCTGGG - Intergenic
953997435 3:47530872-47530894 CCTCAGTGTCCCCAGTAGCTGGG + Intergenic
955753177 3:62203304-62203326 CCACCGAGGCCACTGTGGCCTGG - Exonic
955934170 3:64086937-64086959 CCTCTGTGGTCCCTGCAGCCCGG + Intergenic
956524162 3:70139396-70139418 CCACAGTGGGTCCTGAAGACAGG - Intergenic
959088418 3:101876409-101876431 TCACAGTGTGTCCTGTAGCCAGG - Intergenic
959933758 3:112009406-112009428 CCTCAGTGTCCCCTCTGGCCTGG + Intronic
960827932 3:121811815-121811837 CCACAGTCTCCCCTGTCCCCAGG - Intronic
961817655 3:129559562-129559584 CCACTGGGGCCCCTGTGGCAGGG - Intronic
963720066 3:148851870-148851892 TCACAGTGGGCCCTGGAGCCAGG + Intronic
964191204 3:154003083-154003105 CCTCAGTGCCCCCAGTAGCTGGG - Intergenic
964787186 3:160409958-160409980 CCTCAGTGTCCCAAGTAGCCGGG - Intronic
965755830 3:172026184-172026206 CCTCAGTGTCCCCAGTAGCTGGG + Intergenic
966211166 3:177454802-177454824 CCACAGTGGGCCCCGTGGCCAGG - Intergenic
970528057 4:16952863-16952885 GCACAGTGGCACTCGTAGCCTGG + Intergenic
971221994 4:24717029-24717051 CCAGGCTGGCCCCTGTAGACTGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973623352 4:52748969-52748991 CCTCAGTCTCCCCTGTAGCTGGG + Intronic
974126136 4:57697913-57697935 CCTCAGTGCCCCCAGTAGCTGGG - Intergenic
976504389 4:85830361-85830383 ACACAGTGGCCCTTGCTGCCTGG - Intronic
977770250 4:100849534-100849556 ACACAGTGGGCGCTGTAGCCTGG + Intronic
979931142 4:126632211-126632233 CCACAGTGGCCCCTTCACGCTGG + Intergenic
980032107 4:127843801-127843823 CTGCAGTGGCCCCTGCTGCCAGG - Intergenic
983069847 4:163254695-163254717 CCACTGCGGCCCCTGTGGACTGG - Intergenic
983640719 4:169941917-169941939 CTACAGTTGCCCATGTGGCCTGG + Intergenic
985772933 5:1824485-1824507 GCACCGTGGCCCCTGTGCCCGGG + Intergenic
985852628 5:2399853-2399875 CCGCAGAAGCCCCAGTAGCCTGG - Intergenic
985995356 5:3594612-3594634 GCAAAGTGGCCCCGGGAGCCGGG + Intergenic
986151774 5:5136621-5136643 CCACTCTGGCCTCTATAGCCTGG + Intergenic
986593478 5:9395657-9395679 TCAAAGTGGCCCCCGTAGCTAGG + Intronic
990238796 5:53796657-53796679 TCTCAGTGGCCCCTGGAGTCAGG + Intergenic
992338558 5:75798719-75798741 TCACACTGGCACCTGTAGACTGG + Intergenic
997658283 5:135571321-135571343 CCACAGTGGCCCCTGTAGCCGGG - Exonic
998225522 5:140323430-140323452 CAGCAGTGGCCCCAGCAGCCGGG - Intergenic
999147702 5:149406864-149406886 GCAGAGTGGCCTCTGTGGCCAGG + Intergenic
1000410836 5:160934047-160934069 CCCCTGTGGCCCCTGAAGGCAGG - Intergenic
1000470475 5:161633712-161633734 CCTCAGTGTCCCCAGTAGCTGGG - Intronic
1000912171 5:167035856-167035878 CCTCAGTCTCCCCTGTAGCTGGG + Intergenic
1001024901 5:168215801-168215823 GCACTGTGGCCCATGGAGCCAGG - Intronic
1001365525 5:171134804-171134826 CCTCAGCCTCCCCTGTAGCCGGG - Intronic
1001536241 5:172499940-172499962 CCTCAGTTTCCCCAGTAGCCAGG - Intergenic
1002099813 5:176851780-176851802 CCACAGTTGCCCCTCAAGACAGG - Intronic
1002813233 6:654686-654708 CCACAGCCTCCCCTGTAGCTGGG - Intronic
1003435166 6:6081483-6081505 CCACAGTGGCCACAGTGTCCAGG - Intergenic
1004493661 6:16142656-16142678 CCCCTGAGGCCCCTGTGGCCAGG - Intronic
1005369447 6:25115574-25115596 CTACAGTGGACCATGTTGCCAGG + Intergenic
1007446704 6:41912162-41912184 CCTCAGTGTCCCATGTAGCTGGG + Intronic
1007817416 6:44534469-44534491 CTGCAGTGGCCCCTGCAGGCGGG - Intergenic
1010522011 6:76849551-76849573 CCACAGCGGCCCCTTTACCCAGG + Intergenic
1012930481 6:105311095-105311117 CCACAGTCACCACTCTAGCCTGG + Intronic
1013865803 6:114694755-114694777 CCCCAGTGGGTCCTGTAGGCAGG + Intergenic
1016384087 6:143514063-143514085 CCTCAGTGGCCACTGAACCCTGG + Intergenic
1016431238 6:143988487-143988509 CCACAGTAGCCCCTGATGCCAGG - Intronic
1017954819 6:159169287-159169309 CCCCCGTCGCCCCTGTCGCCCGG + Intergenic
1018927659 6:168217595-168217617 CCACAGTTACCCCAGCAGCCTGG - Intergenic
1019337235 7:491218-491240 CGGCAGTGGCTCCTGCAGCCTGG + Intergenic
1021462828 7:20908520-20908542 ACACAATGGCCCATGTAGACAGG - Intergenic
1023614893 7:42009902-42009924 CCACAGTAGCCCCAGTGGACTGG + Intronic
1025780910 7:64601022-64601044 TCACAATGCCCCCTGTAGGCAGG - Intergenic
1025785083 7:64636667-64636689 TCACAGTGCCCCCTGTAGTCAGG - Intergenic
1026854777 7:73746019-73746041 CCACAGTCTCCCCAGTAGCTGGG + Intergenic
1026938917 7:74275457-74275479 CCACAGTGTCCCCTGCAGGCAGG - Intergenic
1028591480 7:92500640-92500662 CCCCAGTGGCCACTGTTCCCAGG + Intronic
1029114326 7:98229525-98229547 CCACAGTGGCAGGTGCAGCCAGG + Intronic
1029207697 7:98879091-98879113 CCACAGCGCCCCCTCTGGCCCGG + Intronic
1030031380 7:105372971-105372993 CCTCAGTGGCCCAAGTAGCTGGG - Intronic
1030820705 7:114087545-114087567 CCACAGTGGCCCCGGCGGGCAGG + Intronic
1032442079 7:131949733-131949755 CCACAGAGACACCTGGAGCCTGG + Intergenic
1033012025 7:137633094-137633116 CCTCAGTGGCCCAAGTAGCTGGG - Intronic
1033403670 7:141051329-141051351 CCACAGGGGCTTCTGAAGCCAGG - Intergenic
1034820686 7:154213720-154213742 CCACAGCCTCCCCTTTAGCCTGG + Intronic
1036117024 8:5969925-5969947 CCTGAGTGGCCCCTGCAGGCAGG + Intergenic
1040375482 8:46820755-46820777 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1040376151 8:46826440-46826462 TCACAATGCCCTCTGTAGCCAGG - Intergenic
1040379413 8:46857899-46857921 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1040952130 8:52947969-52947991 CCAGCCTGGCCGCTGTAGCCAGG - Intergenic
1041983618 8:63893429-63893451 CCTCAGTCTCCCCAGTAGCCGGG - Intergenic
1044538585 8:93384927-93384949 CCTCAGTGTCCCATGTAGCAGGG - Intergenic
1044866971 8:96580932-96580954 CCACAGGGGCCTCTGTAGTATGG + Intronic
1046710542 8:117506400-117506422 CCACAGTTGCACCTCTAGCCTGG + Intergenic
1047327346 8:123852412-123852434 ACTCAGTGGTCGCTGTAGCCAGG + Intronic
1047529625 8:125663291-125663313 CCTCAGTGTCCCCAGAAGCCTGG - Intergenic
1048060855 8:130917936-130917958 CCACATCTGGCCCTGTAGCCTGG + Intronic
1048923335 8:139250134-139250156 GCACAGGGACCCCTGTGGCCTGG - Intergenic
1052382291 9:27784802-27784824 CCACAGGCGCCCCTCTCGCCAGG + Intergenic
1054455643 9:65428975-65428997 CCACAGAGGCCCTTGTTGCAGGG - Intergenic
1056553684 9:87672198-87672220 CAGCAGTGGCCCCTGTGGCTGGG + Intronic
1056617440 9:88180520-88180542 CCTCATTGCCCCCTGGAGCCAGG - Intergenic
1057131000 9:92654702-92654724 CCACAGAGCTCCCTGTAACCTGG + Intronic
1057610855 9:96542602-96542624 CCTCAGTGTCCCCAGTAGCAAGG + Intronic
1058834177 9:108846510-108846532 CCACAGCCTCCCATGTAGCCAGG + Intergenic
1059304310 9:113341777-113341799 CCAAACTGGTACCTGTAGCCAGG + Intergenic
1060231781 9:121830791-121830813 CTACAGAGCCCCCTGTGGCCTGG - Intronic
1061250922 9:129425991-129426013 CCACACTGGCCCCTGGCCCCTGG + Intergenic
1061898834 9:133662641-133662663 CCACAGTGGGCCGCGTGGCCTGG + Intergenic
1062373857 9:136253372-136253394 CCAGAGTGGCCTCTGTGGCCAGG - Intergenic
1062414292 9:136439885-136439907 CCACAGCGGCCCCTGGCGGCCGG + Intergenic
1062416583 9:136454237-136454259 CCCCCGGGGCCCCTGGAGCCGGG - Exonic
1185667661 X:1779692-1779714 CCACAGTGGCGCCTGTGTCATGG + Intergenic
1187976812 X:24711096-24711118 CCTCAGTGTCCCGAGTAGCCAGG + Intronic
1189294186 X:39907322-39907344 CCACAGAGGCCCCAGGAGGCAGG + Intergenic
1189846412 X:45142725-45142747 CCACAGTGCCTCTTGTAGACAGG - Intergenic
1190247841 X:48702262-48702284 CCACAGTGACCCCAGTGACCTGG + Intronic
1190937360 X:55008749-55008771 CCAGGGTAGCCCCTGAAGCCAGG - Exonic
1197869875 X:131054611-131054633 CCGCAGTGTTCCCTGTAGCTAGG + Intergenic
1200863746 Y:8020520-8020542 TCACAGTGTCCCCTGTAGGCAGG + Intergenic
1200890335 Y:8316858-8316880 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1202080395 Y:21078184-21078206 TCACAATGGCCCCTGTTGGCAGG - Intergenic
1202254838 Y:22910254-22910276 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1202259961 Y:22960062-22960084 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1202263231 Y:22991772-22991794 CCACAGTGCTCTCTGTAGGCAGG - Intronic
1202407829 Y:24544003-24544025 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1202412947 Y:24593806-24593828 TCACAGTGTCCCCTGTGGGCAGG - Intergenic
1202416221 Y:24625513-24625535 CCACAGTGCTCTCTGTAGGCAGG - Intronic
1202454566 Y:25044573-25044595 CCACAGTGCTCTCTGTAGGCAGG + Intronic
1202457834 Y:25076264-25076286 TCACAGTGTCCCCTGTGGGCAGG + Intergenic
1202462953 Y:25126078-25126100 TCACAGTGTCCCCTGTGGGCAGG + Intergenic