ID: 997658660

View in Genome Browser
Species Human (GRCh38)
Location 5:135573859-135573881
Sequence GAGGACAGACATAAGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997658653_997658660 20 Left 997658653 5:135573816-135573838 CCTTCGCATGGTACAGGGGAGCT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 997658660 5:135573859-135573881 GAGGACAGACATAAGACCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997658660 Original CRISPR GAGGACAGACATAAGACCCC AGG Intronic
902659533 1:17891574-17891596 GAGGACACACCTCAGACCTCAGG + Intergenic
905295388 1:36951397-36951419 AAGGAGAAACAAAAGACCCCAGG - Intronic
905357533 1:37395147-37395169 GAAGACAGAGCTAAGTCCCCTGG - Intergenic
906109056 1:43311513-43311535 GAGGACAGAGTTCAGGCCCCTGG - Intronic
906528991 1:46512515-46512537 GAGGGGACACCTAAGACCCCTGG - Exonic
906660284 1:47577143-47577165 GAGGACACACAGGAGACCCCAGG + Intergenic
907680127 1:56555264-56555286 GGGGACAGATAAAAGTCCCCGGG - Intronic
910044129 1:82891071-82891093 GAGAACAGACATGAGACCAGTGG - Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
918308367 1:183267624-183267646 AAGGGCAGACATCTGACCCCAGG + Intronic
920823608 1:209403864-209403886 GAGGACAGACATAAAACTGTTGG + Intergenic
921155463 1:212434811-212434833 GAGGACTGAGAAAAGACCCTTGG + Intronic
922485243 1:225968994-225969016 GGAGACAGACATAAGCCTCCAGG + Intergenic
922787503 1:228290269-228290291 GAGGACACAGATTAGCCCCCGGG - Intronic
924004952 1:239599005-239599027 CAGGAGAGAAATAAGATCCCAGG - Intronic
1063628291 10:7711641-7711663 GATGAGAGACATCAGACCCCAGG - Intronic
1064780435 10:18831917-18831939 GAGTACACACATAAGAGCCCTGG - Intergenic
1066145588 10:32554401-32554423 GAGGACAGACAGAGGACCAGGGG - Intronic
1068597491 10:58918936-58918958 GAAAACAGACATTAGACCCTTGG + Intergenic
1069306973 10:66982883-66982905 GGGGAGAAGCATAAGACCCCAGG + Intronic
1075480729 10:122779803-122779825 GAGGACAGAAATCACATCCCTGG + Intergenic
1076317269 10:129551387-129551409 CAGGAAAGACAGAAGGCCCCGGG + Intronic
1076319751 10:129569212-129569234 GACGATAGACATAAAACACCTGG + Intronic
1078735306 11:14014195-14014217 CAGCACAGACATAAGGCACCAGG - Intronic
1078993321 11:16670726-16670748 GAAGACAAACAAAAGACCCTTGG + Intronic
1080183825 11:29455579-29455601 GAGGACATAGATAAGACATCTGG - Intergenic
1081850942 11:46274760-46274782 GAAGGCAGACTTAAGACCCAGGG + Intergenic
1081861509 11:46335757-46335779 GAGGACAGACAGACAAGCCCTGG + Intronic
1082165418 11:48944609-48944631 GAGGACAGATATATGATCCGAGG - Intergenic
1082169283 11:48982754-48982776 GAGGACAGATATATGATCCGAGG + Intergenic
1085347561 11:75778091-75778113 GGGGACAGAGCTAAGACCCAAGG - Intronic
1085557186 11:77434889-77434911 GATTACAGACATAAGCCACCAGG + Intronic
1087218938 11:95524887-95524909 GAGAACAGACAGCAGATCCCTGG + Intergenic
1092100543 12:5880276-5880298 GGAGACAGACATAAGAGCCTGGG + Intronic
1095462574 12:42458116-42458138 GAGGACAGACACAAGTCCAATGG - Exonic
1097302477 12:58033889-58033911 GTGGACAGACTCAAGACCTCTGG + Intergenic
1098494145 12:71115408-71115430 GAGGACAGAGAGAAGTGCCCTGG - Intronic
1098599512 12:72314064-72314086 GACAAAAGACATGAGACCCCTGG - Intronic
1103706222 12:122874612-122874634 TAGGACACACATAAGCCACCAGG + Intronic
1103805450 12:123569018-123569040 GATTACAGGCATAAGCCCCCGGG + Intergenic
1105892376 13:24690774-24690796 AAGGACAGACCTGAGAGCCCAGG - Intronic
1108431575 13:50359040-50359062 GAGGACGGAAATAAAATCCCTGG + Intronic
1113900942 13:113797558-113797580 GGGGACAGACATGAGACCACAGG - Intronic
1113902983 13:113806750-113806772 GAGGCCAGAGAGAAGCCCCCAGG - Intronic
1115103740 14:29734849-29734871 GAAGACAGAGATAAGAGCTCAGG - Intronic
1115715883 14:36102691-36102713 GAGGTCAGAAAGAAGACCCTTGG - Intergenic
1116607930 14:47026829-47026851 GAGGAAAGAAAAAAGCCCCCAGG + Intronic
1118283148 14:64447424-64447446 GATGACAGGCATAAGCCACCAGG + Intronic
1119703815 14:76771915-76771937 GCCCACAGACTTAAGACCCCTGG + Intronic
1121328082 14:93033469-93033491 GAGCACAGACATCAGAACCAGGG + Intronic
1123415700 15:20093470-20093492 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1123525039 15:21100584-21100606 GAGGACAGACAGAAGTCTGCAGG + Intergenic
1124973937 15:34516269-34516291 GACGAGAAACATAAAACCCCAGG + Intergenic
1127332838 15:57955597-57955619 GAGGGCACACAGATGACCCCAGG + Intronic
1127395652 15:58542105-58542127 CAGGACTGACACCAGACCCCAGG + Intronic
1128715206 15:69903026-69903048 CAGGACAGGCGTATGACCCCAGG - Intergenic
1132533414 16:465306-465328 GAGGCCAAGCACAAGACCCCAGG + Intronic
1132986578 16:2770573-2770595 CAGGACAGACATCAGGCCACAGG - Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1134817069 16:17214457-17214479 GGGGAAAGACATAATGCCCCAGG - Intronic
1138245814 16:55466571-55466593 GAGGACAAACAGAAATCCCCTGG - Intronic
1139350168 16:66329892-66329914 GAGGAAAGACAGCAGACCCAGGG - Intergenic
1141768453 16:86073987-86074009 GAGGAGAGACATCAGCCCCTAGG - Intergenic
1142467611 17:145194-145216 CAGGACAGTGACAAGACCCCAGG + Intergenic
1144421732 17:15104833-15104855 GGGGACAAACTTAAGACACCAGG + Intergenic
1147057219 17:37843958-37843980 CAGGACAGTGACAAGACCCCAGG - Intergenic
1147212181 17:38878047-38878069 GAGGACATACATCAGATACCAGG - Intronic
1150464845 17:65383735-65383757 GAGGACAAAAATCAGACACCTGG + Intergenic
1150897964 17:69236053-69236075 GAGGACAAAGATAAGATCCTGGG + Intronic
1151896275 17:76982906-76982928 GGGGACAGACATAAAACCTTGGG + Intergenic
1152149477 17:78589945-78589967 GAGAACAGACACCAGCCCCCAGG - Intergenic
1153706584 18:7751484-7751506 GATGAGAGACTCAAGACCCCAGG - Intronic
1153828811 18:8901349-8901371 GTGGACAGACTCAGGACCCCTGG - Intergenic
1155052904 18:22164242-22164264 GGGGACAGACAGCAGACCCTGGG + Intergenic
1156937610 18:42729815-42729837 GAGGAAAGAGATAAGTCCCCAGG + Intergenic
1163501295 19:17678057-17678079 GAGGACAGAGATACAAACCCGGG - Intronic
1164738003 19:30556185-30556207 GGGGCCTGACATTAGACCCCAGG + Intronic
1168195863 19:54773227-54773249 AAGGAGAGAGATAAGACACCAGG + Intronic
926233676 2:11023681-11023703 GAAGGCAGACTGAAGACCCCAGG + Intergenic
926947553 2:18204268-18204290 GAGGACACACATTCCACCCCTGG - Intronic
927335746 2:21922265-21922287 AAGGAGAGACATAAGACCAAGGG + Intergenic
927398429 2:22682823-22682845 GAGGTCAGACATTTGACCACGGG - Intergenic
930491564 2:52079832-52079854 AAAGACTGACAGAAGACCCCAGG - Intergenic
934039643 2:88117146-88117168 GAGGAGAGACACAAAAACCCAGG - Intergenic
936030454 2:109066641-109066663 GGGGACAGACACAAGGGCCCTGG - Intergenic
938866742 2:135429908-135429930 GATTATAGACATAAGACACCAGG - Intronic
940036462 2:149317033-149317055 GAGTACAGAAATAAGATCACAGG + Intergenic
941005947 2:160247217-160247239 GAGGTCAGAGATGAGAACCCTGG + Intronic
942147701 2:173042754-173042776 GAGGACAGACACAGCACCACAGG - Intronic
945285643 2:208078651-208078673 GTGGACAGACTTAGGACCTCTGG - Intergenic
947595760 2:231410658-231410680 GAGGAAAGAGTTAAGACCCTGGG - Intergenic
1171449561 20:25226067-25226089 AGGGACAGCCATAACACCCCCGG + Exonic
1172215620 20:33233633-33233655 TAGCACAGACATGAAACCCCAGG + Intergenic
1172486020 20:35298257-35298279 GAGGCCAGACCTCAGGCCCCTGG - Intergenic
1172489761 20:35326529-35326551 GAGCACAGGCATAACACACCAGG + Intronic
1172991329 20:39039084-39039106 GAGGACAGACAGAAGCCACTGGG - Exonic
1173070193 20:39756866-39756888 GAGGACAGAGAGCAGTCCCCTGG - Intergenic
1174162486 20:48561547-48561569 GAGGACAGACTGAAGACCCCTGG + Intergenic
1174168908 20:48604291-48604313 GGGCACACACAGAAGACCCCAGG + Intergenic
1174854334 20:54028651-54028673 CAGGACACAGATAAAACCCCAGG - Exonic
1175324872 20:58116616-58116638 CAGGCCAGACACAGGACCCCTGG + Intergenic
1175806863 20:61834319-61834341 GAGGCCAGACCCCAGACCCCAGG - Intronic
1177512554 21:22108768-22108790 GAGGGCAGACAGAAGACCACTGG + Intergenic
1178346798 21:31835746-31835768 CAGGAAAGACAGAAGAGCCCAGG - Intergenic
1182544386 22:31066009-31066031 GAGGACAGACAGAAGTCTGCAGG - Intronic
1183533802 22:38382499-38382521 GAGAACAGACATAATAGCCCTGG - Intronic
1185364424 22:50430599-50430621 GATGACAGGCATAAGTCACCAGG - Intronic
952137044 3:30434282-30434304 GAGGACAGAGTTAAGAGCCATGG - Intergenic
953916247 3:46922848-46922870 GAAGACAGACACAAGCCTCCCGG + Intronic
956602158 3:71033876-71033898 GAGGTCAGACAGAAGCACCCTGG - Intronic
958996917 3:100915588-100915610 GAGGCCAAGCATAAGAACCCAGG + Intronic
959293123 3:104500012-104500034 GATTACAGGCATAAGCCCCCAGG + Intergenic
961313928 3:126021475-126021497 TAGAACAGACAGAAGACACCTGG - Intronic
962090613 3:132240586-132240608 GAGGGCAGAGATAAGAACCATGG + Intronic
962357703 3:134709038-134709060 GTGGACACATATAAGACCCAGGG + Intronic
962708629 3:138067828-138067850 GAAGACAGCCAGGAGACCCCTGG + Intronic
964805413 3:160604401-160604423 GTGTACATACATATGACCCCTGG - Intergenic
967046883 3:185745611-185745633 GAGGACAGACAGAAGACGGTTGG - Intronic
968566581 4:1316638-1316660 GTGGAAAGAGAGAAGACCCCTGG - Intronic
969693732 4:8723494-8723516 GGGGACAGACATACGAAGCCAGG + Intergenic
969839410 4:9869655-9869677 GAGGACAGCCACCAGACCCTTGG - Intronic
974594642 4:63999787-63999809 GAGGACTGACAGAGTACCCCTGG + Intergenic
980152380 4:129062894-129062916 GACGTCAGACATAAGACCCAAGG - Intronic
980442704 4:132868704-132868726 GAGAACAGACATTAGGCACCAGG + Intergenic
981177804 4:141702553-141702575 GTGGACAGACTCAGGACCCCTGG + Intronic
981520083 4:145652127-145652149 GAAGACACACATAAGAAGCCTGG + Intronic
984598978 4:181704758-181704780 GAGTACAGACATGAGCCACCGGG - Intergenic
984991842 4:185388361-185388383 GTAGGCAGAAATAAGACCCCGGG - Intronic
994778110 5:104061315-104061337 GTGGACAGACGCAAGACCTCTGG + Intergenic
995914027 5:117221446-117221468 GAGGACATACCCAAGAGCCCAGG + Intergenic
996302531 5:122006418-122006440 GAGGAAAGACATAAATACCCAGG - Intronic
997658660 5:135573859-135573881 GAGGACAGACATAAGACCCCAGG + Intronic
998521099 5:142801446-142801468 GAGGAAAGACATGAGATCCATGG + Intronic
999108681 5:149095780-149095802 GTGGACAGACTCAAGACCTCTGG - Intergenic
1000083032 5:157865213-157865235 GACTACAGGCATAAGTCCCCAGG - Intergenic
1000324525 5:160162189-160162211 CAGGAAAGACACAAGACCACTGG - Intergenic
1001341641 5:170852040-170852062 AAGAACAGTCAAAAGACCCCAGG + Intergenic
1005231900 6:23711343-23711365 GAGCACTGACCTAAGACTCCAGG + Intergenic
1007216788 6:40246517-40246539 GCGGATAGTCATTAGACCCCCGG - Intergenic
1017345037 6:153370208-153370230 GAAGGCAGACAAAAGACCCTTGG + Intergenic
1019922008 7:4169087-4169109 GAGGAAAGTCAGAAGCCCCCAGG + Intronic
1021421612 7:20451205-20451227 GATGAAAGACATATGACTCCAGG + Intergenic
1021543351 7:21785137-21785159 GAGGTCTGGCAGAAGACCCCAGG - Intronic
1022462011 7:30618203-30618225 GAGAAGAGACATAAAACACCTGG - Intronic
1023140285 7:37094956-37094978 CAGGACAGACATATGTCCCTTGG + Intronic
1028347419 7:89799302-89799324 GGGAAAAGACATAAGACTCCTGG + Intergenic
1029600416 7:101559957-101559979 GAGAACAGACATAATACACAGGG - Intergenic
1030811071 7:113972802-113972824 GAGGACAGTTATAAGATCCTAGG - Intronic
1033035832 7:137875455-137875477 GAGAACAGAGCTAAAACCCCTGG + Exonic
1034103846 7:148473921-148473943 GAGGACAGACAAAAGTCCTCTGG - Intergenic
1035570785 8:671082-671104 GAGCACAGACATTAGAGCCGGGG - Intronic
1035570797 8:671140-671162 GAGCACAGACATTAGAACCGGGG - Intronic
1035570851 8:671372-671394 GAGCACAGACATTAGAGCCGGGG - Intronic
1035570863 8:671430-671452 GAGCACAGACATTAGAGCCGGGG - Intronic
1035570875 8:671488-671510 GAGCACAGACATTAGAACCGGGG - Intronic
1035570954 8:671835-671857 GAGCACAGACATTAGAGCCGGGG - Intronic
1039407176 8:37323320-37323342 AAGGAAAGACTGAAGACCCCCGG + Intergenic
1041448899 8:57986104-57986126 GAGGACACACATCAGAAGCCAGG - Intergenic
1042537572 8:69873990-69874012 GAGGACAGACATAAAAGCCTTGG + Intergenic
1051933990 9:22422235-22422257 GAGGTCAGACATTAGAGACCAGG - Intergenic
1051990111 9:23142898-23142920 TGGGACAGACATAAAACCCTAGG + Intergenic
1058238830 9:102529480-102529502 AAGGACAGATATTAGACTCCAGG + Intergenic
1060760285 9:126241437-126241459 GAGGACAGACAGTAGCCACCTGG - Intergenic
1061472583 9:130838525-130838547 AAGGACACACATAAAACTCCAGG - Intronic
1061482970 9:130906199-130906221 GAGGCCTGGCATGAGACCCCGGG - Intronic
1185660359 X:1723057-1723079 GGGGACAGTCAAAAGATCCCTGG + Intergenic
1187847556 X:23556589-23556611 GAGGACAGACATATGGCTACAGG + Intergenic
1188516861 X:30997108-30997130 GAGGACAGAGAAAAGCCACCAGG - Intergenic
1189082460 X:37989498-37989520 GAGGGCAGATTTATGACCCCAGG + Intronic
1190262065 X:48803520-48803542 GAAGACAGACTTAAGACCAGGGG + Intronic
1190649792 X:52557654-52557676 GAGGGCACACATGATACCCCTGG + Intergenic
1191016843 X:55818517-55818539 GTGGACAGACTCAGGACCCCTGG + Intergenic
1201282610 Y:12354295-12354317 GACGCCAGACATCAGAGCCCAGG + Intergenic
1202593645 Y:26513511-26513533 GAGAACAGACATAATAGCCCTGG + Intergenic