ID: 997662284

View in Genome Browser
Species Human (GRCh38)
Location 5:135598833-135598855
Sequence GGTTTACGGACGCTGCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662284_997662286 -5 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662286 5:135598851-135598873 AAACCAGCAGAACCAGTCTGTGG No data
997662284_997662289 2 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662289 5:135598858-135598880 CAGAACCAGTCTGTGGTCGGTGG No data
997662284_997662288 -1 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662288 5:135598855-135598877 CAGCAGAACCAGTCTGTGGTCGG No data
997662284_997662292 18 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662292 5:135598874-135598896 TCGGTGGTCTCTTATCAGGAAGG 0: 16
1: 25
2: 58
3: 62
4: 115
997662284_997662291 14 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662291 5:135598870-135598892 GTGGTCGGTGGTCTCTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662284 Original CRISPR GGTTTACGGACGCTGCGCAC AGG (reversed) Intergenic
No off target data available for this crispr