ID: 997662286 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:135598851-135598873 |
Sequence | AAACCAGCAGAACCAGTCTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997662284_997662286 | -5 | Left | 997662284 | 5:135598833-135598855 | CCTGTGCGCAGCGTCCGTAAACC | No data | ||
Right | 997662286 | 5:135598851-135598873 | AAACCAGCAGAACCAGTCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997662286 | Original CRISPR | AAACCAGCAGAACCAGTCTG TGG | Intergenic | ||