ID: 997662286

View in Genome Browser
Species Human (GRCh38)
Location 5:135598851-135598873
Sequence AAACCAGCAGAACCAGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662284_997662286 -5 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662286 5:135598851-135598873 AAACCAGCAGAACCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662286 Original CRISPR AAACCAGCAGAACCAGTCTG TGG Intergenic
No off target data available for this crispr