ID: 997662288

View in Genome Browser
Species Human (GRCh38)
Location 5:135598855-135598877
Sequence CAGCAGAACCAGTCTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662284_997662288 -1 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662288 5:135598855-135598877 CAGCAGAACCAGTCTGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662288 Original CRISPR CAGCAGAACCAGTCTGTGGT CGG Intergenic
No off target data available for this crispr