ID: 997662289

View in Genome Browser
Species Human (GRCh38)
Location 5:135598858-135598880
Sequence CAGAACCAGTCTGTGGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662284_997662289 2 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662289 5:135598858-135598880 CAGAACCAGTCTGTGGTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662289 Original CRISPR CAGAACCAGTCTGTGGTCGG TGG Intergenic
No off target data available for this crispr