ID: 997662291

View in Genome Browser
Species Human (GRCh38)
Location 5:135598870-135598892
Sequence GTGGTCGGTGGTCTCTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662287_997662291 -7 Left 997662287 5:135598854-135598876 CCAGCAGAACCAGTCTGTGGTCG No data
Right 997662291 5:135598870-135598892 GTGGTCGGTGGTCTCTTATCAGG No data
997662285_997662291 0 Left 997662285 5:135598847-135598869 CCGTAAACCAGCAGAACCAGTCT No data
Right 997662291 5:135598870-135598892 GTGGTCGGTGGTCTCTTATCAGG No data
997662284_997662291 14 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662291 5:135598870-135598892 GTGGTCGGTGGTCTCTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662291 Original CRISPR GTGGTCGGTGGTCTCTTATC AGG Intergenic
No off target data available for this crispr