ID: 997662291 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:135598870-135598892 |
Sequence | GTGGTCGGTGGTCTCTTATC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997662285_997662291 | 0 | Left | 997662285 | 5:135598847-135598869 | CCGTAAACCAGCAGAACCAGTCT | No data | ||
Right | 997662291 | 5:135598870-135598892 | GTGGTCGGTGGTCTCTTATCAGG | No data | ||||
997662284_997662291 | 14 | Left | 997662284 | 5:135598833-135598855 | CCTGTGCGCAGCGTCCGTAAACC | No data | ||
Right | 997662291 | 5:135598870-135598892 | GTGGTCGGTGGTCTCTTATCAGG | No data | ||||
997662287_997662291 | -7 | Left | 997662287 | 5:135598854-135598876 | CCAGCAGAACCAGTCTGTGGTCG | No data | ||
Right | 997662291 | 5:135598870-135598892 | GTGGTCGGTGGTCTCTTATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997662291 | Original CRISPR | GTGGTCGGTGGTCTCTTATC AGG | Intergenic | ||