ID: 997662292

View in Genome Browser
Species Human (GRCh38)
Location 5:135598874-135598896
Sequence TCGGTGGTCTCTTATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 16, 1: 25, 2: 58, 3: 62, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997662285_997662292 4 Left 997662285 5:135598847-135598869 CCGTAAACCAGCAGAACCAGTCT No data
Right 997662292 5:135598874-135598896 TCGGTGGTCTCTTATCAGGAAGG 0: 16
1: 25
2: 58
3: 62
4: 115
997662287_997662292 -3 Left 997662287 5:135598854-135598876 CCAGCAGAACCAGTCTGTGGTCG No data
Right 997662292 5:135598874-135598896 TCGGTGGTCTCTTATCAGGAAGG 0: 16
1: 25
2: 58
3: 62
4: 115
997662284_997662292 18 Left 997662284 5:135598833-135598855 CCTGTGCGCAGCGTCCGTAAACC No data
Right 997662292 5:135598874-135598896 TCGGTGGTCTCTTATCAGGAAGG 0: 16
1: 25
2: 58
3: 62
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997662292 Original CRISPR TCGGTGGTCTCTTATCAGGA AGG Intergenic
900716859 1:4150595-4150617 TCGCTGGTCTCTCTCCAGGATGG + Intergenic
901067246 1:6500178-6500200 CCTGTGGGCTCCTATCAGGAAGG - Intronic
902454097 1:16519508-16519530 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
902498374 1:16890810-16890832 TCGGTGGTCTCTTATCAGGAGGG + Intronic
904341948 1:29841236-29841258 TCAGTGGCCTCTTATCAGGAAGG - Intergenic
904996876 1:34638225-34638247 TCAGTGGTCTCTTATCAGGAAGG + Intergenic
908426995 1:64017213-64017235 TCCCTGCTCTCCTATCAGGAAGG - Intronic
908469011 1:64423743-64423765 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
908598546 1:65713758-65713780 TTGGTTGTCTCTGTTCAGGATGG + Intergenic
910780398 1:90926144-90926166 TTGGTGATCTCTTATCAGTAAGG - Intronic
911686717 1:100785903-100785925 TTGGCGGTCTCTTATCAGGAAGG + Intergenic
913229879 1:116732893-116732915 TCAGTGGTGTCTAATGAGGAAGG + Intergenic
913615732 1:120558240-120558262 TCGGTGGTCTCCGGTCAGCATGG + Intergenic
913644410 1:120843156-120843178 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
913654885 1:120951201-120951223 TCAGTGGTCTCTTATCAGGAGGG - Intergenic
914006185 1:143734505-143734527 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
914082324 1:144420422-144420444 TCGGTGGTCTCTTATCAGGAGGG + Intergenic
914098777 1:144566406-144566428 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
914177228 1:145288921-145288943 TCGGTGGTCTCTTATCAGGAGGG + Intergenic
914300207 1:146371260-146371282 TCGGTGGTCTCTTATCAGGAGGG + Intergenic
914531957 1:148530414-148530436 TCGGTGGTCTCTTATCAGGAGGG + Intergenic
914574544 1:148952662-148952684 TCGGTGGTCTCCGGTCAGCATGG - Intronic
914636435 1:149557319-149557341 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
914645082 1:149645393-149645415 TCAGTGGTCTCTTATCAGGAGGG - Intergenic
915059494 1:153169257-153169279 TAGGTGGCCTTTTATCAGGAAGG - Intergenic
916899350 1:169203634-169203656 TTGGTGGTCTCTAATCAGGAAGG + Intronic
917072732 1:171169943-171169965 TCAGTGATCTCTTATCAGTCAGG - Intergenic
920145154 1:203854173-203854195 TCTGGGGTCTCTTGTCAAGATGG - Intergenic
920801034 1:209187735-209187757 TCAGTAGTCTCTTATCAGGAAGG + Intergenic
920978588 1:210809680-210809702 TGAGTGGTCTCTTATCAGGAAGG + Intronic
922074871 1:222233648-222233670 ATGGCGGTTTCTTATCAGGAAGG - Intergenic
922231320 1:223689367-223689389 TCAGTGATCTCTTACCAGGAAGG + Intergenic
923293488 1:232570039-232570061 TAGGTGTTTTCTTATCAGAAAGG - Intergenic
1063254300 10:4309225-4309247 TCAGTGCTGTCTTATCAGGAAGG + Intergenic
1068987934 10:63124130-63124152 TCAGTGGTCTATTATCAGGAAGG + Intergenic
1070972668 10:80580419-80580441 TCGGTGGTCTCTTATCAGGAAGG + Intronic
1071834275 10:89404317-89404339 GCAGTGGTCACTTATCAGGAGGG - Intronic
1073128030 10:101164408-101164430 TCAGTGGTCTCTGATCAGGAAGG + Intergenic
1073980173 10:109145159-109145181 TTGGTGGTCTCTTATTAGGAAGG - Intergenic
1075386345 10:122058042-122058064 TGGGTGGTCTCTTGTGTGGAAGG - Intronic
1078635610 11:13046893-13046915 TCGATGGTCACGGATCAGGAAGG - Intergenic
1082705266 11:56487047-56487069 TTGGTGGTCTCTTATCAAGAAGG - Intergenic
1084035420 11:66506938-66506960 TTGGTGGTCACTTCTCATGATGG + Intronic
1084662462 11:70554177-70554199 CCTGTGATTTCTTATCAGGAGGG - Intronic
1086576748 11:88347330-88347352 TCGGTGGTCTCTCATCAGGAAGG + Intergenic
1088053974 11:105553156-105553178 TTGATGGTCTGTTATCAGGAAGG + Intergenic
1089718866 11:120393001-120393023 TCGGAGTTCTCTTAAAAGGAAGG + Intronic
1090541539 11:127711708-127711730 TCGGTGATCTCTCATCAGGAAGG - Intergenic
1090825134 11:130379863-130379885 TTGCTGGTCTCTGATCAGTAAGG - Intergenic
1092128590 12:6092686-6092708 TTGGTGGTCTCTTACCAGGAAGG - Intronic
1097178727 12:57158703-57158725 TCGGTGCCCTCTCAGCAGGATGG + Intronic
1097544574 12:60982869-60982891 TCAGTGGTCCCTTATCAGGACGG + Intergenic
1098546959 12:71722019-71722041 TCAGTGGTTATTTATCAGGAAGG - Intergenic
1099620790 12:85000645-85000667 TTGCTGGTCTCTTATTAAGAAGG - Intergenic
1100716746 12:97313963-97313985 TGGATGGTCTCTTATCAAAAAGG + Intergenic
1101462752 12:104913455-104913477 TCACTGGTCTCTTACCAGGAAGG - Intronic
1103674792 12:122647177-122647199 TGGGTGGTCTTTTCTCAGAAAGG + Intergenic
1104408322 12:128537233-128537255 TTAGTGGTCTCTTATTAGGAAGG + Intronic
1106612437 13:31296439-31296461 TCTGTGGCCTCTTCTCAGAAGGG + Intronic
1107019867 13:35740404-35740426 TCAGTGGTCTCTTATCAGGAAGG - Intergenic
1107380859 13:39855328-39855350 TTGGAGATCACTTATCAGGAAGG - Intergenic
1107712956 13:43168784-43168806 TCAGCAGCCTCTTATCAGGAAGG + Intergenic
1107931890 13:45313863-45313885 TCTCTGCTCTCTTATCAGGAAGG - Intergenic
1108921116 13:55675516-55675538 TTGGTGATATCTTAACAGGAAGG + Intergenic
1109604466 13:64674508-64674530 TTGGTTGTCTCTTATCAGGAAGG + Intergenic
1112766573 13:102752083-102752105 TTGGTAGTCTCTTATCAGGAAGG - Intronic
1113225189 13:108152005-108152027 TCTGTGATCTCTTATCAGAAAGG + Intergenic
1113526897 13:110986478-110986500 TTGGTGGTCTCTTACCAGGAAGG - Intergenic
1113701348 13:112390947-112390969 CCAGTGGTCTCTCACCAGGAAGG + Intronic
1116475793 14:45337724-45337746 TTAGTGGTCATTTATCAGGAAGG + Intergenic
1117171045 14:53096653-53096675 GCTGTGGTATCTTCTCAGGAAGG - Intronic
1118497454 14:66322451-66322473 TCTTTGGTCTCCTATAAGGATGG - Intergenic
1120223832 14:81767491-81767513 TCCCTGGTCTCTTATCAGCAAGG - Intergenic
1120538204 14:85722841-85722863 TGGGTGGTCTCTTACCAGGAAGG + Intergenic
1121443478 14:93963822-93963844 TGGGTGGTGTCATATCTGGATGG + Intronic
1121572126 14:94954321-94954343 TGGGTGATCTCTTCTCAGGAAGG + Intergenic
1122647341 14:103203880-103203902 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1122657167 14:103269827-103269849 TCGGTGGTCTCTTATCAGGAGGG - Intergenic
1123572900 15:21632933-21632955 TAGTTGGTCTCTTATCAGGAAGG - Intergenic
1123609520 15:22075520-22075542 TAGTTGGTCTCTTATCAGGAAGG - Intergenic
1127526886 15:59801933-59801955 TAGATGGTTTCTTAGCAGGATGG - Intergenic
1130730127 15:86483277-86483299 TTGATGGTCTCTTATCAGCAAGG + Intronic
1130957596 15:88638607-88638629 TCAGTGGTCTCTTATGGGGTAGG - Intronic
1131409990 15:92199619-92199641 TTGGTGGTCTCTTATCAGGAAGG + Intergenic
1131453766 15:92567192-92567214 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1132283871 15:100644930-100644952 TATGTGGTCTCTTAACAGAATGG - Intronic
1202981762 15_KI270727v1_random:367305-367327 TAGTTGGTCTCTTATCAGGAAGG - Intergenic
1133872935 16:9706423-9706445 TCTGTGGTCTCTTATCAGGAAGG - Intergenic
1134100572 16:11448879-11448901 TCGGTGGTCTCTTGGCTGCACGG + Intronic
1134402621 16:13924026-13924048 TCGGTGGGCTTTGATCAGAAAGG - Intronic
1135680843 16:24455406-24455428 TCGGTGGTCATTTATCAGGAAGG + Intergenic
1135918600 16:26627682-26627704 ATGGTGGTCTCTTCTCAGGAAGG - Intergenic
1137441578 16:48503004-48503026 TCAGAGGTCTCTTTCCAGGAAGG + Intergenic
1139043942 16:63033576-63033598 TTGGTGGCCCCTTATCAGGAAGG - Intergenic
1139280883 16:65769454-65769476 GTGGTGGTCTCTTATCAGGAAGG - Intergenic
1139839342 16:69865856-69865878 TCAGTGGCCTCTTATCAGAAAGG + Intronic
1140353360 16:74283551-74283573 TTGGTGGCCTCTTATCAGGAAGG - Intergenic
1142013578 16:87730809-87730831 TAGCTGGGCTCTTAGCAGGATGG - Intronic
1143793259 17:9315361-9315383 TCCATGGTCTCTTACCAGGAGGG - Intronic
1143835248 17:9686809-9686831 TCTGTCTTCCCTTATCAGGAAGG - Exonic
1144601198 17:16615621-16615643 TCTGAGGTTTGTTATCAGGATGG - Intergenic
1147541114 17:41360752-41360774 TTGGTGGTCTCTTATCAGGAAGG + Intergenic
1148983222 17:51597693-51597715 TCAGTGGTCTCTTATTAGGAAGG + Intergenic
1153444370 18:5155191-5155213 TCGATGGTCTCTTATCCCAAAGG - Intronic
1155696296 18:28690851-28690873 TTGGTGGTCTCTCATCAGGAAGG + Intergenic
1155940266 18:31795580-31795602 TAGGTGGTCTATCATTAGGAAGG + Intergenic
1156661477 18:39351168-39351190 CAGATGGTCTCTTACCAGGAAGG - Intergenic
1165401739 19:35605257-35605279 TAGGTGGCCTCTGATCAGGAAGG - Intergenic
925145255 2:1578445-1578467 CCAGTGGTCTCCTGTCAGGAAGG - Intergenic
925312938 2:2900146-2900168 CCAGTGGTCTGTTATCAGGAAGG - Intergenic
926233244 2:11020613-11020635 CCAGTGGTCTCTTATCAAAAAGG - Intergenic
926758451 2:16254439-16254461 TCGGTGGTCTCTTATCAGGAAGG - Intergenic
926865342 2:17351034-17351056 TCTGTTGTCTCTTATCATAAGGG + Intergenic
928247366 2:29642351-29642373 TCGGTTGTCCTTTATCAGCAAGG + Intronic
929991563 2:46793864-46793886 TCAGCAGTCTCTTATCAGGAAGG + Intergenic
930110735 2:47676447-47676469 TTAGTGGTCTCTTATCAGGAAGG - Intergenic
932056807 2:68453946-68453968 TTAGTGGCCTCTTATCAGGAAGG - Intergenic
933177497 2:79191957-79191979 TTGCTGGTCACTTACCAGGAAGG + Intronic
934025207 2:87996728-87996750 GCAGTGGTTTCTTATCAGGAAGG + Intergenic
935734979 2:106099386-106099408 ATGGTGGTCTCTTATGATGAGGG - Intronic
936591560 2:113809302-113809324 TCAGTGGTGTCTTATCAGGAAGG - Intergenic
938694184 2:133820218-133820240 TCTGTTGCCTGTTATCAGGATGG - Intergenic
941153288 2:161941621-161941643 TCAGTGTTCTCTTATTGGGAAGG + Intronic
941690737 2:168498719-168498741 CTGGTGGTCTCTTACCAGGAAGG + Intronic
943476859 2:188367713-188367735 TCTGTGGCCTCTTAACAGAATGG + Intronic
943635525 2:190302495-190302517 TCAGTGGTCTTTTATTAGGAAGG + Intronic
943696125 2:190934166-190934188 TTGGTGGTTTCTTAGCATGATGG + Intronic
944141286 2:196459724-196459746 TCTGTGGTCTCTTATCAAGAAGG - Intronic
944949207 2:204727902-204727924 TCAGTGGTCTCTTACCAGGAAGG + Intronic
946119504 2:217497321-217497343 TTGGTGGTCTCTTATTAGGAAGG + Intronic
947485805 2:230547765-230547787 ACAGTGGTCATTTATCAGGAAGG + Intergenic
947932513 2:233975411-233975433 TTGGTGGCCTCTTCTCAGAATGG + Intronic
947956587 2:234197374-234197396 TTGGTGTGCTCTTCTCAGGATGG - Intergenic
1169410376 20:5364260-5364282 TCAGGGGTTTCTTATCAGGAAGG + Intergenic
1170466428 20:16626546-16626568 TTGGTGGTCTCTTTTCTGGAAGG - Intergenic
1171723192 20:28587203-28587225 TGGGTGGTCTCTCATCTGGATGG + Intergenic
1171754852 20:29095904-29095926 TGGGTGGTCTCTCATCTGGATGG - Intergenic
1171787798 20:29486638-29486660 TGGGTGGTCTCTCATCTGGATGG + Intergenic
1171860151 20:30392753-30392775 TGGGTGGTCTCTCATCTGGATGG - Intronic
1174925079 20:54750478-54750500 CTGGTGGTCTCTTATCAGGAAGG - Intergenic
1177246579 21:18532847-18532869 TCAGTGCTGTCTTATAAGGAAGG - Intergenic
1177838310 21:26210004-26210026 TCGGTGTTCTTTTGTCAGGAAGG + Intergenic
1180296753 22:10945853-10945875 TGGGTGTTCTCTCATCTGGATGG + Intergenic
1180411852 22:12619707-12619729 TGGGTGGTCTCTCATCTGGATGG - Intergenic
1183355189 22:37355048-37355070 TCGCTGGTTCCTTTTCAGGACGG + Intergenic
1183701326 22:39452868-39452890 ACAATGGTTTCTTATCAGGAAGG + Intergenic
1184918372 22:47588795-47588817 CTGGTGGTCTCTCGTCAGGAAGG - Intergenic
949966563 3:9361781-9361803 TGGGTGATCTCTTATCAGGAAGG - Intronic
951356283 3:21670899-21670921 TCGGTGGTCTCTTACCCACAAGG - Intronic
951757397 3:26106229-26106251 TTGGTGGTCATTTATCAGGAAGG + Intergenic
952704986 3:36368139-36368161 TCCTTGGTCTCTTATCGGGAAGG - Intergenic
955379012 3:58421954-58421976 TTGGAGGTCTCTTGGCAGGAAGG + Intronic
955664125 3:61332333-61332355 TGGGTGGTCTCTCATCAGGAAGG + Intergenic
958625108 3:96613524-96613546 TTGGTGGTCTGTTGACAGGAAGG - Intergenic
958672917 3:97227880-97227902 TTGGTGGTCTCTTATCAGGAAGG + Intronic
959157657 3:102686047-102686069 TCTGTGGTCTCTTATCAGAAAGG - Intergenic
959781554 3:110240271-110240293 TCAGTGGTCACGTATCAGGAAGG + Intergenic
961870071 3:129981029-129981051 TTGGTGGTCTTCTATCAGGAAGG + Intergenic
963087894 3:141455465-141455487 TTCGTCGTCTCTTATCACGATGG + Intergenic
963762374 3:149296647-149296669 TTGGTTGTCTCTTATCAGGAAGG - Intergenic
963762719 3:149300395-149300417 TTGTTGGTCTCTTATCAGGAAGG - Intergenic
963877277 3:150490513-150490535 TTGGTGGTCTCTTACCAAGAAGG - Intergenic
964801486 3:160564437-160564459 CTGGTGGTCTCCTCTCAGGAGGG + Intronic
968728131 4:2257655-2257677 ACAGTGGTCTCCAATCAGGAGGG - Intronic
968846571 4:3045721-3045743 TCTGTGGTCTCTTACCAGGAAGG + Intergenic
968963052 4:3755082-3755104 CCCGTGGTCTCCTATCAGGAAGG - Intergenic
970820387 4:20205221-20205243 TCTGTGGTCTCCTATCAGGAAGG + Intergenic
971336628 4:25729189-25729211 TTGGTGGTCATTTATCAGGAAGG - Intergenic
972673264 4:41234596-41234618 TCAATGGTCTCTTATTAGGAAGG + Intergenic
973283530 4:48388993-48389015 TCACTGGTCTCATAACAGGATGG - Intronic
973581026 4:52344336-52344358 TCATTGGCCTCCTATCAGGAAGG - Intergenic
973733119 4:53842853-53842875 TCGGTGGTCTCTTATTAGGAAGG + Intronic
973925219 4:55730014-55730036 TCCATGGTCTCTTATCAGGAAGG - Intergenic
976286684 4:83377212-83377234 TTGGTGATCTCTTATCATGAAGG - Intergenic
977636974 4:99310494-99310516 TGAGTGTTCTCTTTTCAGGAAGG + Intronic
977721120 4:100241508-100241530 TTGGTGCTCTCTTACCAGGGAGG + Intergenic
979590991 4:122480167-122480189 TCAGTAGTCTCTTATCAGGAAGG + Intergenic
979940536 4:126757380-126757402 TCAGTGGTCAGTTATCAGGAAGG + Intergenic
980117477 4:128693006-128693028 CTGGTGGCCTCTTACCAGGAAGG - Intergenic
980827664 4:138091798-138091820 TCAATGGTCTCTTATCAGGAAGG + Intergenic
983770448 4:171542092-171542114 GTGGTCGTCTCTTATCAGAAAGG - Intergenic
984192245 4:176619849-176619871 TCGGTGGTCTCTTACCAGGAAGG + Intergenic
984522460 4:180817950-180817972 TCAGTGGTCTCTTATCAGGATGG + Intergenic
984904950 4:184618000-184618022 GGTGTTGTCTCTTATCAGGAGGG + Intergenic
985438318 4:189956580-189956602 TGGGTGGTCTCTCATCTGGATGG - Intronic
985549878 5:527788-527810 GCGGTGGTCTCTTTCCTGGAAGG - Intergenic
985882179 5:2646514-2646536 TCGGTGGTCTCCCATCAGGAAGG - Intergenic
986448078 5:7840426-7840448 TCTGTGGTCTCTTTTAAGGTAGG - Intronic
986861966 5:11936960-11936982 CCAGTGGTCTCTTATTGGGAAGG - Intergenic
987203381 5:15600220-15600242 TCAGTGGTCTCTTATCAGGAAGG + Intronic
987270661 5:16305030-16305052 TCGGTGATCTCTCATCAGGAAGG + Intergenic
987675723 5:21070470-21070492 TCAGTGGTCTCTTATCAGAAAGG - Intergenic
991125108 5:63061007-63061029 TCTGTTGTCTCTTCTTAGGAGGG - Intergenic
992395288 5:76363880-76363902 TCAGTGGCCTCTTATCATGGGGG - Intergenic
992468358 5:77029667-77029689 TTGGTGGTCTCTTATCAGGAAGG - Intronic
992893874 5:81230605-81230627 TCTGTGGTCAGTTATGAGGATGG + Intergenic
996820502 5:127621300-127621322 TTGGTGGTCCCTTATCAGAAAGG + Intergenic
997662292 5:135598874-135598896 TCGGTGGTCTCTTATCAGGAAGG + Intergenic
1000192271 5:158923016-158923038 TAGGTGGTCTATTAGCAGGAGGG + Intronic
1001059614 5:168477313-168477335 TGGGTGGCCTCTTATCAGGAAGG - Intergenic
1002921902 6:1578963-1578985 TCCGTGGTCTCTTTTCAGCCTGG - Intergenic
1003024610 6:2543027-2543049 TTGGTGGTTTCTTATCAGGAAGG - Intergenic
1003192929 6:3889982-3890004 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1003798032 6:9628358-9628380 TTGGTGGTCTCCTATCAAGAAGG + Intronic
1006412144 6:33880189-33880211 TTGGTGGTCTCTTCACAGGGAGG + Intergenic
1008104132 6:47424675-47424697 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1008982615 6:57502367-57502389 TTAGTAGTCTCTTGTCAGGAGGG - Intronic
1009170688 6:60395230-60395252 TTAGTAGTCTCTTGTCAGGAGGG - Intergenic
1011354508 6:86460180-86460202 TTGGTGGTCATTTATCAGGAAGG - Intergenic
1011630759 6:89321746-89321768 TCAGTGGTCACTTATCAGGAAGG + Intergenic
1011809393 6:91112996-91113018 TCAGTAGTCTCTTATCCGAAAGG - Intergenic
1011859614 6:91738303-91738325 TGGGTGATCTTTTATAAGGATGG + Intergenic
1012196494 6:96348122-96348144 CCGATGGTCAGTTATCAGGATGG + Intergenic
1012710954 6:102603850-102603872 TTGGTGGTCTCTTATAAGGCAGG - Intergenic
1012805515 6:103887682-103887704 TTCGTGGTCTCTTACCAGGAAGG + Intergenic
1013092340 6:106911725-106911747 GCAGTGGTCTCTTATCAGGAAGG + Intergenic
1013554615 6:111243237-111243259 ACCCTGGTCTCTTATGAGGAAGG + Intergenic
1015515664 6:134080413-134080435 CCAGTGGTCTCTTATCAGGAAGG - Intergenic
1016560520 6:145391324-145391346 TCGGTGGTCTCTTATCAGGAAGG - Intergenic
1016561564 6:145400527-145400549 TCAGTGGTCTCTTATCAAGAAGG - Intergenic
1017354224 6:153483123-153483145 TTGGTGATCTCTAATCAGGAAGG - Intergenic
1018056195 6:160054431-160054453 GTTGTGGTCTCTTATCAGCAGGG + Intronic
1018922015 6:168181874-168181896 TTGGTGCTCTCTTGTCGGGAAGG - Intergenic
1019155438 6:170035758-170035780 TCAGTGCTCTCCCATCAGGAAGG - Intergenic
1019225791 6:170506928-170506950 TCGGTGGTCTCTTATCAGGAAGG + Intergenic
1019308974 7:349752-349774 TGGGTGGTCTCTCAGCAGCAAGG - Intergenic
1020269262 7:6583221-6583243 TCAGTTGTGTTTTATCAGGACGG + Intronic
1020450994 7:8320312-8320334 TCAGTGGTCTCTTATCAGGAAGG + Intergenic
1026561568 7:71454854-71454876 TCAGTGGTCTCTTATCAAGAAGG + Intronic
1026848502 7:73710792-73710814 TCGGTGCTCTCGCGTCAGGACGG + Intronic
1028071961 7:86461317-86461339 TCAGTGGTCTCTTATTGGGAAGG - Intergenic
1030642654 7:112023545-112023567 TCTCTGGTCTCTGATCCGGAAGG - Intronic
1032134412 7:129262524-129262546 TTGGTGGTCTCCTATTAGGAAGG + Intronic
1034542884 7:151770197-151770219 TCAGGGGTCTCTTATCAGGAAGG - Intronic
1034658948 7:152752627-152752649 TTGGTGGTCTCTCATCAGGAAGG + Intergenic
1035232899 7:157477000-157477022 TCAGTGGTCTCTTACCAGGCAGG - Intergenic
1037123575 8:15318390-15318412 TTGATGGTCTCTTATCAGGAAGG + Intergenic
1037134945 8:15449448-15449470 CTGGTGGTCTCTTACCAGGAAGG + Intronic
1038347239 8:26743588-26743610 TCTGTGGTCTCTCATCAGGAGGG - Intergenic
1039814027 8:41076270-41076292 TTGGTGGTCTCTTTTCAAAAAGG - Intergenic
1041757325 8:61328739-61328761 TTGGTTGTCTCTCAGCAGGAGGG + Intronic
1041956598 8:63562889-63562911 TCTGTGGTCAATTGTCAGGAGGG - Intergenic
1042205838 8:66328903-66328925 CTGGTGGTCTCTCATCAGGAAGG - Intergenic
1043091608 8:75911857-75911879 TCAGTGTTCTTTTATCAAGAAGG + Intergenic
1047398639 8:124527356-124527378 CTGGTGGTCACTTGTCAGGAAGG + Intronic
1049033933 8:140060234-140060256 TCTGTGGTCTCTCATCCAGAAGG + Intronic
1050830686 9:10008349-10008371 TTGGTGGTCTCTCATCAGGAAGG - Intronic
1053612077 9:39724300-39724322 TGGGTGGTCTCTTATTGGGAAGG - Intergenic
1053747290 9:41211571-41211593 TGGGTGGTCTCTCATCTCGATGG - Intergenic
1053870111 9:42482292-42482314 TGGGTGGTCTCTTATTGGGAAGG - Intergenic
1054086180 9:60746856-60746878 TGGGTGGTCTCTTATTGGGAAGG + Intergenic
1054241441 9:62618093-62618115 TGGGTGGTCTCTTATTGGGAAGG + Intergenic
1054339040 9:63838634-63838656 TGGGTGGTCTCTCATCTTGATGG + Intergenic
1054479995 9:65653789-65653811 TGGGTGGTCTCTCATCTCGATGG + Intergenic
1054555569 9:66652616-66652638 TGGGTGGTCTCTTATTGGGAAGG + Intergenic
1054771217 9:69086095-69086117 TGGGCAGTCTGTTATCAGGAAGG + Intronic
1055329698 9:75171093-75171115 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1056104846 9:83336920-83336942 TCAGTGGTCTCTTACCAGGAAGG - Intronic
1056920472 9:90783700-90783722 CCAGTGGTCTTTTATCAGGAAGG + Intergenic
1058189157 9:101891872-101891894 TCGGTGGTCTCTTATGAAGAAGG - Intergenic
1058826074 9:108777085-108777107 TCAGTGGTCTCTTATCAGGAAGG - Intergenic
1059479469 9:114577253-114577275 TTGGTGACCTCTTAACAGGAAGG + Intergenic
1059825980 9:118029553-118029575 TCCATGGTCTCTTATAAGAAAGG + Intergenic
1060067373 9:120514452-120514474 TGGCTGGTTTCTTGTCAGGATGG - Intronic
1062251294 9:135596449-135596471 TCAGTGGTCTCTTATCAGGAAGG - Intergenic
1202783423 9_KI270718v1_random:22350-22372 TGGGTGGTCTCTCATCTCGATGG - Intergenic
1202803615 9_KI270720v1_random:27022-27044 TGGGTGTTCTCTCATCTGGATGG + Intergenic
1203448407 Un_GL000219v1:84093-84115 TGGGAGGTCTCTCATCTGGATGG + Intergenic
1186934449 X:14432363-14432385 TTGGTGATCTCTTATCATCAAGG - Intergenic
1187791564 X:22955936-22955958 ACAGTGGTCTCTTACCAGGAAGG - Intergenic
1189150488 X:38701286-38701308 TTGGTGGTCTCTTATCAGGAAGG - Intergenic
1189551312 X:42096434-42096456 TCGGTGGCCTCTTATCAGGAAGG - Intergenic
1194761119 X:97797286-97797308 ACAGTGGTCTTTTATCAGGGAGG - Intergenic
1196534385 X:116824912-116824934 TTGGTGATCTCTTATCAGGAAGG + Intergenic
1197648896 X:129043816-129043838 ATGGTGGTCTCTTATCAGTGTGG + Intergenic
1200428233 Y:3046000-3046022 CCGGTGGTGGCTTATCAGGGTGG + Intergenic