ID: 997665092

View in Genome Browser
Species Human (GRCh38)
Location 5:135624189-135624211
Sequence ATGAGGCATCCTGAGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997665083_997665092 17 Left 997665083 5:135624149-135624171 CCTCCTTAGCTGGGTGCTTGAGA No data
Right 997665092 5:135624189-135624211 ATGAGGCATCCTGAGAACCTGGG No data
997665084_997665092 14 Left 997665084 5:135624152-135624174 CCTTAGCTGGGTGCTTGAGAGTT No data
Right 997665092 5:135624189-135624211 ATGAGGCATCCTGAGAACCTGGG No data
997665082_997665092 23 Left 997665082 5:135624143-135624165 CCGTTACCTCCTTAGCTGGGTGC No data
Right 997665092 5:135624189-135624211 ATGAGGCATCCTGAGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997665092 Original CRISPR ATGAGGCATCCTGAGAACCT GGG Intergenic
No off target data available for this crispr