ID: 997668795

View in Genome Browser
Species Human (GRCh38)
Location 5:135653687-135653709
Sequence TGGAGATTGGTCTGTCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997668795_997668799 -2 Left 997668795 5:135653687-135653709 CCCATAAGACAGACCAATCTCCA No data
Right 997668799 5:135653708-135653730 CACTCCCCATAAGCTTCCTTTGG No data
997668795_997668803 8 Left 997668795 5:135653687-135653709 CCCATAAGACAGACCAATCTCCA No data
Right 997668803 5:135653718-135653740 AAGCTTCCTTTGGAAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997668795 Original CRISPR TGGAGATTGGTCTGTCTTAT GGG (reversed) Intergenic
No off target data available for this crispr