ID: 997669282

View in Genome Browser
Species Human (GRCh38)
Location 5:135657058-135657080
Sequence ATTCAGATGCCCATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997669282_997669288 -4 Left 997669282 5:135657058-135657080 CCCTCCTCAATGGGCATCTGAAT No data
Right 997669288 5:135657077-135657099 GAATGGGCACTCACAATATTGGG No data
997669282_997669291 27 Left 997669282 5:135657058-135657080 CCCTCCTCAATGGGCATCTGAAT No data
Right 997669291 5:135657108-135657130 TCAGAGGGTGAGTGTTGCAAAGG No data
997669282_997669289 11 Left 997669282 5:135657058-135657080 CCCTCCTCAATGGGCATCTGAAT No data
Right 997669289 5:135657092-135657114 ATATTGGGTACTCTTCTCAGAGG No data
997669282_997669290 12 Left 997669282 5:135657058-135657080 CCCTCCTCAATGGGCATCTGAAT No data
Right 997669290 5:135657093-135657115 TATTGGGTACTCTTCTCAGAGGG No data
997669282_997669287 -5 Left 997669282 5:135657058-135657080 CCCTCCTCAATGGGCATCTGAAT No data
Right 997669287 5:135657076-135657098 TGAATGGGCACTCACAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997669282 Original CRISPR ATTCAGATGCCCATTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr