ID: 997669768

View in Genome Browser
Species Human (GRCh38)
Location 5:135661184-135661206
Sequence CTGCTGTTCTGGAGGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997669768_997669778 23 Left 997669768 5:135661184-135661206 CCTGTCTGCCTCCAGAACAGCAG No data
Right 997669778 5:135661230-135661252 TCACCGGATAGGCAGATGCGGGG No data
997669768_997669776 21 Left 997669768 5:135661184-135661206 CCTGTCTGCCTCCAGAACAGCAG No data
Right 997669776 5:135661228-135661250 CTTCACCGGATAGGCAGATGCGG No data
997669768_997669772 7 Left 997669768 5:135661184-135661206 CCTGTCTGCCTCCAGAACAGCAG No data
Right 997669772 5:135661214-135661236 AGCTGCCTCTCTTCCTTCACCGG No data
997669768_997669774 12 Left 997669768 5:135661184-135661206 CCTGTCTGCCTCCAGAACAGCAG No data
Right 997669774 5:135661219-135661241 CCTCTCTTCCTTCACCGGATAGG No data
997669768_997669777 22 Left 997669768 5:135661184-135661206 CCTGTCTGCCTCCAGAACAGCAG No data
Right 997669777 5:135661229-135661251 TTCACCGGATAGGCAGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997669768 Original CRISPR CTGCTGTTCTGGAGGCAGAC AGG (reversed) Intergenic
No off target data available for this crispr