ID: 997670424

View in Genome Browser
Species Human (GRCh38)
Location 5:135666807-135666829
Sequence TTGGCCCTCCAAAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997670424_997670437 13 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670437 5:135666843-135666865 TGACTATGGGGAAAGGCGGGAGG No data
997670424_997670431 -1 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670431 5:135666829-135666851 AGGGTGTAGGGTGGTGACTATGG No data
997670424_997670434 6 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670434 5:135666836-135666858 AGGGTGGTGACTATGGGGAAAGG No data
997670424_997670435 9 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670435 5:135666839-135666861 GTGGTGACTATGGGGAAAGGCGG No data
997670424_997670429 -10 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670429 5:135666820-135666842 GGAGGGCCAAGGGTGTAGGGTGG No data
997670424_997670433 1 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670433 5:135666831-135666853 GGTGTAGGGTGGTGACTATGGGG No data
997670424_997670436 10 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670436 5:135666840-135666862 TGGTGACTATGGGGAAAGGCGGG No data
997670424_997670439 25 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670439 5:135666855-135666877 AAGGCGGGAGGAGATTCAATGGG No data
997670424_997670432 0 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670432 5:135666830-135666852 GGGTGTAGGGTGGTGACTATGGG No data
997670424_997670438 24 Left 997670424 5:135666807-135666829 CCTTGCTCATTTTGGAGGGCCAA No data
Right 997670438 5:135666854-135666876 AAAGGCGGGAGGAGATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997670424 Original CRISPR TTGGCCCTCCAAAATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr