ID: 997671305

View in Genome Browser
Species Human (GRCh38)
Location 5:135675640-135675662
Sequence AGCAAAAGAAACAAAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29564
Summary {0: 10, 1: 203, 2: 5064, 3: 16172, 4: 8115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997671305_997671308 10 Left 997671305 5:135675640-135675662 CCTCCAGCTTTGTTTCTTTTGCT 0: 10
1: 203
2: 5064
3: 16172
4: 8115
Right 997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG No data
997671305_997671309 28 Left 997671305 5:135675640-135675662 CCTCCAGCTTTGTTTCTTTTGCT 0: 10
1: 203
2: 5064
3: 16172
4: 8115
Right 997671309 5:135675691-135675713 ATCGGTTCCATATGAATTTTAGG No data
997671305_997671307 -9 Left 997671305 5:135675640-135675662 CCTCCAGCTTTGTTTCTTTTGCT 0: 10
1: 203
2: 5064
3: 16172
4: 8115
Right 997671307 5:135675654-135675676 TCTTTTGCTCAAGATTGCTTTGG 0: 5
1: 55
2: 370
3: 1306
4: 3385
997671305_997671310 29 Left 997671305 5:135675640-135675662 CCTCCAGCTTTGTTTCTTTTGCT 0: 10
1: 203
2: 5064
3: 16172
4: 8115
Right 997671310 5:135675692-135675714 TCGGTTCCATATGAATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997671305 Original CRISPR AGCAAAAGAAACAAAGCTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr