ID: 997671306

View in Genome Browser
Species Human (GRCh38)
Location 5:135675643-135675665
Sequence TTGAGCAAAAGAAACAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997671306_997671310 26 Left 997671306 5:135675643-135675665 CCAGCTTTGTTTCTTTTGCTCAA No data
Right 997671310 5:135675692-135675714 TCGGTTCCATATGAATTTTAGGG No data
997671306_997671308 7 Left 997671306 5:135675643-135675665 CCAGCTTTGTTTCTTTTGCTCAA No data
Right 997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG No data
997671306_997671309 25 Left 997671306 5:135675643-135675665 CCAGCTTTGTTTCTTTTGCTCAA No data
Right 997671309 5:135675691-135675713 ATCGGTTCCATATGAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997671306 Original CRISPR TTGAGCAAAAGAAACAAAGC TGG (reversed) Intergenic
No off target data available for this crispr